Transcript asmbl_13908

Sequence
Transcript Sequence for observation asmbl_13908 of TGE0002864:
TGCATATTTTAGGAAGTGAGGAGGAGGCGCGGGCTGGAGCTGCGGCGGGGTCTGGGGCGCAGAGCAGCGGCGGGAGGAGGCGGACACGTGGCAACAGCGGTAGCAGCCCGGGCGGCGGCAGCAACAGCGGCGGCGGCATCGGCCCGAGCCGCCGGCCGCCCTCCCACCCTCCCGCCCCGCGGCAGCCCTAGCTCCCTCCACTTGGCTCCCCTGGTCCCGCTCGCTCGGCCGGGAGCTGCTCTGTGCTTTTCTCTCTGATTCTCCAGCGACAGGACCCGGCGCCGGGCACTGAGCACCGCCACCATGGGGAAGGGGGTTGGACGTGATAAGTATGAGCCTGCAGCTGTTTCAGAACAAGGTGATAAAAAGGGCAAAAAGGGCAAAAAAGACAGGGACATGGATGAACTGAAGAAAGAAGTTTCTATGGATGATCATAAACTTAGCCTTGATGAACTTCATCGTAAATATGGAACAGACTTGAGCCGGGGATTAACATCTGCTCGTGCAGCTGAGATCCTGGCGCGAGATGGTCCCAACGCCCTCACTCCCCCTCCCACTACTCCTGAATGGATCAAGTTTTGTCGGCAGCTCTTTGGGGGGTTCTCAATGTTACTGTGGATTGGAGCGATTCTTTGTTTCTTGGCTTATAGCATCCAAGCTGCTACAGAAGAGGAACCTCAAAACGATAATCTGTACCTGGGTGTGGTGCTATCAGCCGTTGTAATCATAACTGGTTGCTTCTCCTACTATCAAGAAGCTAAAAGTTCAAAGATCATGGAATCCTTCAAAAACATGGTCCCTCAGCAAGCCCTTGTGATTCGAAATGGTGAGAAAATGAGCATAAATGCGGAGGAAGTTGTGGTTGGGGATCTGGTGGAAGTAAAAGGAGGAGACCGAATTCCTGCTGACCTCAGAATCATATCTGCAAATGGCTGCAAGGTGGATAACTCCTCGCTCACTGGTGAATCAGAACCCCAGACTAGGTCTCCAGATTTCACAAATGAAAACCCCCTGGAGACGAGGAACATTGCCTTCTTTTCAACCAATTGTGTTGAAGGCACCGCACGTGGTATTGTTGTCTACACTGGGGATCGCACTGTGATGGGAAGAATTGCCACACTTGCTTCTGGGCTGGAAGGAGGCCAGACCCCCATTGCTGCAGAAATTGAACATTTTATCCACATCATCACGGGTGTGGCTGTGTTCCTGGGTGTGTCTTTCTTCATCCTTTCTCTCATCCTTGAGTACACCTGGCTTGAGGCTGTCATCTTCCTCATCGGTATCATCGTAGCCAATGTGCCGGAAGGTTTGCTGGCCACTGTCACGGTCTGTCTGACACTTACTGCCAAACGCATGGCAAGGAAAAACTGCTTAGTGAAGAACTTAGAAGCTGTGGAGACCTTGGGGTCCACGTCCACCATCTGCTCTGATAAAACTGGAACTCTGACTCAGAACCGGATGACAGTGGCCCACATGTGGTTTGACAATCAAATCCATGAAGCTGATACGACAGAGAATCAGAGTGGTGTCTCTTTTGACAAGACTTCAGCTACCTGGCTTGCTCTGTCCAGAATTGCAGGTCTTTGTAACAGGGCAGTGTTTCAGGCTAACCAGGAAAACCTACCTATTCTTAAGCGGGCAGTTGCAGGAGATGCCTCTGAGTCAGCACTCTTAAAGTGCATAGAGCTGTGCTGTGGTTCCGTGAAGGAGATGAGAGAAAGATACGCCAAAATCGTCGAGATACCCTTCAACTCCACCAACAAGTACCAGTTGTCTATTCATAAGAACCCCAACACATCGGAGCCCCAACACCTGTTGGTGATGAAGGGCGCCCCAGAAAGGATCCTAGACCGTTGCAGCTCTATCCTCCTCCACGGCAAGGAGCAGCCCCTGGATGAGGAGCTGAAAGACGCCTTTCAGAACGCCTATTTGGAGCTGGGGGGCCTCGGAGAACGAGTCCTAGGTTTCTGCCACCTCTTTCTGCCAGATGAACAGTTTCCTGAAGGGTTCCAGTTTGACACTGACGATGTGAATTTCCCTATCGATAATCTGTGCTTTGTTGGGCTCATCTCCATGATTGACCCTCCACGGGCGGCCGTTCCTGATGCCGTGGGCAAATGTCGAAGTGCTGGAATTAAGGTCATCATGGTCACAGGAGACCATCCAATCACAGCTAAAGCTATTGCCAAAGGTGTGGGCATCATCTCAGAAGGCAATGAGACCGTGGAAGACATTGCTGCCCGCCTCAACATCCCAGTCAGCCAGGTGAACCCCAGGGATGCCAAGGCCTGCGTAGTACACGGCAGTGATCTAAAGGACATGACCTCCGAGCAGCTGGATGACATTTTGAAGTACCACACTGAGATAGTGTTTGCCAGGACCTCCCCTCAGCAGAAGCTCATCATTGTGGAAGGCTGCCAAAGACAGGGTGCTATCGTGGCTGTGACTGGTGACGGTGTGAATGACTCTCCAGCTTTGAAGAAAGCAGACATTGGGGTTGCTATGGGGATTGCTGGCTCAGATGTGTCCAAGCAAGCTGCTGACATGATTCTTCTGGATGACAACTTTGCCTCAATTGTGACTGGAGTAGAGGAAGGTCGTCTGATCTTTGATAACTTGAAGAAATCCATTGCTTATACCTTAACCAGTAACATTCCCGAGATCACCCCGTTCCTGATATTTATTATTGCAAACATTCCACTACCACTGGGGACTGTCACCATCCTCTGCATTGACTTGGGCACTGACATGGTTCCTGCCATCTCCCTGGCTTATGAGCAGGCTGAGAGTGACATCATGAAGAGACAGCCCAGAAATCCCAAAACAGACAAACTTGTGAATGAGCGGCTGATCAGCATGGCCTATGGGCAGATTGGAATGATCCAGGCCCTGGGAGGCTTCTTTACTTACTTTGTGATTCTGGCTGAGAACGGCTTCCTCCCAATTCACCTGTTGGGCCTCCGAGTGGACTGGGATGACCGCTGGATCAACGATGTGGAAGACAGCTACGGGCAGCAGTGGACCTATGAGCAGAGGAAAATCGTGGAGTTCACCTGCCACACAGCCTTCTTCGTCAGTATCGTGGTGGTGCAGTGGGCCGACTTGGTCATCTGTAAGACCAGGAGGAATTCGGTCTTCCAGCAGGGGATGAAGAACAAGATCTTGATATTTGGCCTCTTTGAAGAGACAGCCCTGGCTGCTTTCCTTTCCTACTGCCCTGGAATGGGTGTTGCTCTTAGGATGTATCCCCTCAAACCTACCTGGTGGTTCTGTGCCTTCCCCTACTCTCTTCTCATCTTCGTATATGACGAAGTCAGAAAACTCATCATCAGGCGACGCCCTGGCGGCTGGGTGGAGAAGGAAACCTACTATTAGCCCCCCGTCCTGCACGCCGTGGAGCATCAGGCCACACACTCTGCATCCGACACCCACCCCCTCTTTGTGTACTTCAGTCTTGGAGTTTGGAACTCTACCCTGGTAGGAAAGCACCGCAGCATGTGGGGAAGCAAGACGTCCTGGAATGAAGCATGTAGCTCTATGGGGGGAGGGGGGAGGGCTGCCTGAAAACCATCCATCTGTGGAAATGACAGCGGGGAAGGTTTTTATGTGCCTTTTTGTTTTTGTAAAAAAGGAACACCCGGAAAGACTGAAAGAATACATTTTATATCTGGATTTTTACAAATAAAGATGGCTATTATAATGGAA