Transcript asmbl_137389

Sequence
Transcript Sequence for observation asmbl_137389 of TGE0059586:
TGGAGCGAGCGCGGCAGGTACAGGTGGCCCTGGAGACGGCGCAGCGCAGTGCAGAGGCGGAGCTGCAGAGCAAACGCGCCTCCTTCGCCGAGAAGACGGCACAGCTGGAGCGCTCCCTGCAGGAGGAACACGTGGCTGTGGCACAGCTGCGGGAGGAGGCTGAGCGGCGGGCACAGCAGCAGGCCGAGGCCGAGCGGGCGCGCGAGGAGGCAGAGCGGGAGCTGGAGCGCTGGCAGCTCAAGGCCAACGAGGCGCTACGGCTGCGGCTGCAGGCGGAGGAGGTGGCGCAGCAGAAGAGCCTGGCGCAGGCCGAGGCTGAGAAGCAGAAGGAGGAGGCGGAGCGCGAGGCGCGGCGGCGCGGCAAGGCGGAGGAGCAGGCCGTCCGGCAGCGGGAGCTGGCTGAACAAGAGCTGGAGAAGCAGCGGCAGCTGGCGGAAGGCACCGCGCAGCAGCGCCTGGCCGCGGAGCAGGAGTTGATCCGGCTGCGGGCCGAGACGGAGCAGGGGGAGCAGCAGCGGCAGCTGCTGGAGGAGGAGCTGGCCCGGCTGCAGCGTGAGGCGGCTGCAGCCACGCAGAAACGGCAGGAGCTGGAAGCCGAGCTGGCCAAGGTGCGGGCCGAGATGGAGGTGCTGCTGGCCAGCAAGGCGAGGGCTGAGGAGGAGTCGCGCTCCACCAGCGAGAAGTCCAAGCAGAGGCTGGAGGCCGAGGCCGGCCGGTTCCGCGAGCTGGCCGAGGAGGCCGCCCGCCTGCGTGCCCTGGCGGAAGAGGCCAAGCGGCAGCGGCAGCTGGCCGAGGAAGACGCGGCGCGGCAGCGGGCCGAGGCGGAGCGGGTGCTTGCGGAGAAGCTGGCCGCCATCGGCGAGGCCACGCGGCTCAAGACGGAGGCGGAGATCGCGCTCAAGGAGAAGGAGGCGGAGAACGAGCGCCTGCGGCGGCTGGCGGAGGACGAGGCCTTCCAGCGGCGGCGGCTGGAGGAGCAGGCCGCGCAACACAAGGCTGACATCGAGGAGCGCCTGGCCCAGCTGCGCAAGGCATCGGACAGCGAGCTGGAGCGGCAGAAGGGGCTGGTGGAGGACACGCTGAGGCAGCGGCGGCAGGTGGAGGAGGAGATCCTGGCGCTGAAGGCGAGCTTCGAGAAGGCGGCCGCTGGCAAGGCGGAGCTGGAGCTGGAGCTGGGACGCATCCGCAGCAACGCGGAGGACACGCTGCGCAGCAAGGAGCAGGCCGAGCTGGAGGCTGCGAGGCAGCGGCAGCTGGCGGCGGAGGAGGAGCGGCGGCGCCGTGAGGCTGAGGAGCGCGTGCAGAAGAGCCTGGCGGCCGAGGAGGAGGCCGCACGGCAGCGGAAGGCGGCGCTGGAGGAAGTCGAGCGGCTGAAAGCCAAGGTGGAGGAGGCGCGGCGCCTGCGGGAGCGAGCGGAGCAGGAGTCGGCGCGGCAGCTGCAGCTGGCCCAGGAGGCCGCCCAGAAGCGGCTGCAGGCGGAAGAGAAGGCACACGCCTTCGCGGTGCAGCAGAAGGAGCAGGAGCTACAGCAGACGCTGCAGCAGGAGCAGAGCGTGCTGGACCAGCTGCGCGGCGAGGCGGAGGCGGCCCGGCGGGCGGCTGAGGAGGCGGAGGAGGCCCGGGTGCAGGCGGAGCGTGAGGCGGCGCAGTCCCGGCGGCAGGTGGAAGAGGCCGAGCGGCTGAAGCAGTCGGCAGAGGAGCAGGCACAGGCCCGGGCTCAGGCACAGGCGGCTGCAGAGAAGCTGCGCAAGGAGGCCGAGCAAGAGGCGGCGCGGCGGGCACAGGCGGAGCAGGCGGCCCTGCGGCAGAAGCAGGCAGCTGACGCGGAGATGGAGAAGCATAAGAAATTCGCCGAGCAGACGCTGCGGCAGAAGGCGCAGGTGGAGCAGGAGCTGACAACACTGCGGCTGCAGCTGGAGGAGACCGACCACCAGAAGAACCTGCTGGACGAGGAGCTGCAGCGGCTGAAGGCGGAGGCCACGGAGGCCGCACGCCAGCGCAGCCAGGTGGAGGAGGAGCTCTTCTCGGTGCGCGTGCAGATGGAGGAGCTGAGCAAGCTCAAGGCACGCATCGAGGCTGAGAACCGCGCACTCATCTTGCGTGACAAGGACAATACGCAGCGCTTCCTGCAGGAGGAGGCTGAGAAGATGAAGCAGGTGGCGGAGGAGGCCGCGCGGCTGAGTGTGGCGGCCCAAGAGGCTGCGCGACTGCGGCAGCTGGCAGAGGAGGACCTGGCACAGCAGCGGGCCTTGGCAGAGAAGATGCTCAAGGAGAAGATGCAGGCGGTGCAGGAGGCCACGCGACTCAAGGCTGAGGCGGAACTGCTGCAGCAGCAGAAGGAGCTTGCGCAGGAGCAGGCGCGGCGGCTGCAGGAGGACAAGGAGCAGATGGCGCAGCAGCTGGCGGAGGAGACGCAGGGCTTCCAGCGGACGCTGGAGGCCGAGCGGCAGCGGCAGCTGGAGATGAGCGCTGAGGCTGAGCGCCTCAAGCTGCGTGTGGCCGAGATGAGCCGAGCCCAGGCCCGCGCTGAGGAGGACGCCCAGCGCTTCCGGAAGCAGGCGGAGGAGATCGGTGAGAAGCTGCACCGCACGGAGCTCGCCACCCAGGAGAAGGTGACCCTGGTGCAGACACTGGAGATCCAGCGACAGCAGAGTGACCATGATGCCGAGCGCCTGCGGGAGGCCATCGCTGAGCTGGAGCGTGAGAAGGAGAAGCTCCAACAGGAGGCCAAACTGCTGCAGCTCAAGTCTGAGGAGATGCAGACGGTGCAGCAGGAGCAGCTGCTGCAGGAGACGCAGGCCCTGCAGCAAAGCTTCCTCTCTGAAAAGGACAGCCTGCTACAGCGGGAGCGCTTCATCGAGCAGGAGAAGGCCAAGCTGGAGCAGCTCTTCCAGGACGAGGTGGCCAAGGCACAGCAGCTGCGTGAGGAGCAGCAGCGGCAGCAGCAGCAGATGGAGCAGGAACGGCAGCGGCTGGTGGCCAGCATGGAGGAGGCGCGGCGGCGGCAGCATGAGGCCGAGGAGGGCGTGCGGCGCAAGCAGGAGGAGCTGCAGCAGCTGGAGCAGCAGCGGCGGCAGCAGGAGGAGCTGCTGGCTGAGGAGAACCAGAGGCTGCGTGAGCAGCTGCAGCTCCTGGAGGAGCAGCACCGGGCCGCGCTGGCGCACTCAGAGGAGGTCACTGCCTCGCAGGTGGCTGCCACAAAGACCCTGCCCAATGGCCGGGATGCACTTGATGGCCCCGCGGCAGAGGCAGAGCCGGAGCACAGCTTCGATGGCCTGCGGCGGAAGGTGTCAGCTCAGAGGCTGCAGGAGGCCGGCATCCTGAGTGCGGAGGAGCTGCAGCGGTTGGCGCAGGGCCACACCACGGTGGACGAGCTCGCACGGCGGGAAGACGTGCGCCACTACCTGCAGGGCCGCAGCAGTATCGCAGGGCTGTTGCTGAAGGCCACCAATGAGAAGCTGAGTGTTTACGCCGCCCTGCAGAGGCAGCTGCTGAGTCCCGGCACGGCCCTCATCCTGCTGGAGGCGCAGGCGGCCTCAGGCTTCCTGCTGGACCCTGTGCGGAACCGGCGGCTGACCGTCAACGAGGCTGTGAAGGAGGGTGTGGTGGGCCCCGAGCTGCACCACAAGCTGCTGTCGGCCGAGCGCGCCGTCACTGGCTACAAGGACCCCTACACTGGCCAGCAGATCTCTCTCTTCCAAGCCATGCAGAAGGGCCTCATCGTCCGGGAGCACGGCATCCGCCTGCTGGAGGCCCAGATCGCCACGGGCGGCGTTATCGACCCCGTGCACAGCCACCGCGTGCCCGTGGACGTGGCCTACCGGCGCGGCTACTTCGACGAGGAGATGAACCGCGTCCTGGCGGACCCCAGCGACGACACCAAGGGCTTCTTTGACCC