Transcript asmbl_137385

Sequence
Transcript Sequence for observation asmbl_137385 of TGE0059582:
GGACAGAGTGGCCGCCGGGTGCTGGAGGCTCCGCTGCACCCCGCGCCCCGCGCCCGCCGGCATGGCCGGCCCGCTGCCCGACGAGCAGGACTTCATCCAGGCCTACGAGGAGGTGCGCGAGAAGTACAAAGATGAGCGGGATCGTGTGCAGAAGAAAACCTTCACCAAGTGGGTCAACAAGCACCTCATCAAGGCCCAGAGGCACATCAGTGACCTGTATGAAGACCTCCGCGATGGCCACAACCTCATCTCCCTGCTGGAGGTCCTCTCGGGGGACAGCCTGCCCCGGGAGAAGGGGAGGATGCGTTTCCACAAGCTGCAGAATGTCCAGATTGCCCTGGACTACCTCCGGCACCGCCAGGTGAAGCTGGTGAACATCAGGAATGATGACATCGCTGACGGCAACCCCAAGCTGACCCTTGGCCTCATCTGGACAATCATTCTGCACTTCCAGATCTCAGATATCCAGGTGAGTGGGCAGTCGGAGGACATGACGGCCAAGGAGAAGCTGCTGCTGTGGTCGCAGCGAATGGTGGAGGGGTACCAGGGCCTGCGATGCGACAACTTCACCTCCAGCTGGAGAGACGGCCGCCTCTTCAATGCCATCATCCACCGGCACAAGCCCCTGCTCATCGACATGAACAAGGTGTACCGGCAGACCAACCTGGAGAACCTGGACCAGGCCTTCTCTGTGGCGGAGCGGGACCTGGGAGTGACGCGGCTCCTGGACCCTGAGGACGTGGATGTCCCTCAGCCCGACGAGAAGTCCATCATCACCTACGTCTCGTCGCTGTATGACGCCATGCCCCGCGTGCCGGACGTGCAGGATGGGGTGAGGGCCAACGAGCTGCAGCTGCGCTGGCAGGAGTACCGGGAGCTGGTGCTGCTGCTGCTTCAGTGGATGCGACACCACACGGCCGCCTTTGAGGAACGCAGGTTCCCCTCCAGCTTCGAGGAGATTGAGATCCTGTGGTCTCAGTTCCTGAAGTTTAAGGAGATGGAGCTACCAGCCAAGGAGGCCGACAAGAACAGGTCCAAGGGCATCTACCAATCCCTGGAGGGAGCGGTGCAAGCAGGCCAGCTCAAGGTGCCCCCTGGCTACCACCCGCTGGATGTGGAGAAGGAGTGGGGCAAGCTGCACGTGGCCATCCTGGAGCGGGAGAAGCAGCTCCGCAGCGAGTTTGAGAGGCTGGAGTGTCTTCAGCGCATCGTGACCAAGCTGCAGATGGAGGCGGGGCTGTGTGAGGAGCAGCTGAACCAGGCCGACGCCCTGCTGCAGTCGGATGTCCGGCTGCTGGCTGCAGGCAAAGTGCCACAGCGGGCGGGGGAGGTGGAACGGGACTTGGACAAGGCGGATAGCATGATCCGGCTGCTCTTCAACGACGTGCAGACCCTCAAGGATGGACGGCACCCGCAGGGCGAGCAGATGTACCGCAGGGTGTACCGTCTGCACGAGCGCCTGGTAGCCATCCGCACCGAGTACAACCTACGGCTGAAGGCAGGCGTGGCGGCCCCTGCAACCCAGGTGGCCCAGGTGACTCTGCAGAGTGTGCAGAGGCGCCCCGAGCTGGAGGACTCCACTCTGCGCTACCTGCAGGACCTGCTGGCCTGGGTGGAGGAGAACCAGCACCGTGTGGATGGCGCTGAGTGGGGTGTGGACCTGCCCAGCGTGGAGGCGCAGCTGGGCAGCCACCGAGGCCTGCACCAGTCCATCGAAGAATTCCGGGCCAAGATCGAGCGGGCACGGAGTGACGAGGGCCAGCTCTCCCCCGCCACCCGGGGTGCCTACCGTGACTGCCTGGGTCGGCTGGACCTGCAGTACGCCAAGCTGCTGAACTCCTCCAAGGCCCGCCTCAGGTCCCTGGAGAGCTTGCACAGCTTTGTGGCAGCCGCCACTAAGGAGCTAATGTGGCTGAATGAGAAGGAGGAGGAGGAGGTGGGCTTCGACTGGAGCGACCGCAACACCAACATGACCGCCAAGAAGGAGAGCTACTCGGCGCTGATGCGGGAGCTGGAGCTGAAGGAGAAGAAGATCAAGGAGCTCCAAAATGCTGGGGACCGGCTGCTGCGGGAGGACCACCCGGCCCGGCCCACGGTGGAGTCCTTCCAGGCGGCCCTGCAGACGCAGTGGAGCTGGATGCTACAGCTGTGCTGCTGTATCGAGGCACACCTGAAGGAGAACGCTGCCTACTTTCAGTTCTTCTCAGATGTGCGGGAGGCCGAGGGGCAGTTGCAGAAGCTGCAGGAGGCACTGCGTAGGAAATACAGTTGTGATCGCTCCGCCACCGTCACCCGGCTGGAGGACCTGCTGCAGGATGCCCAGGACGAGAAGGAACAGCTGAACGAGTACAAGGGCCACCTCTCAGGCCTGGCCAAGCGGGCCAAGGCCGTCGTGCAGCTGAAGCCCCGCCACCCAGCCCACCCCATGCGGGGCCGCCTGCCCCTGCTGGCCGTGTGCGACTATAAGCAGGTGGAGGTGACTGTGCACAAGGGTGACGAGTGCCAGCTGGTGGGCCCTGCACAGCCGTCCCACTGGAAGGTGCTCAGCAGCTCCGGCAGCGAGGCCGCCGTGCCCTCCGTGTGCTTCCTGGTGCCCCCGCCCAACCAGGAGGCCCAGGAGGCCGTCACCAGGCTGGAGGCCCAGCACCAGGCCCTGGTCACGCTGTGGCACCAGTTGCACGTGGACATGAAGAGCCTTCTGGCCTGGCAGAGCCTTCGCCGCGACGTGCAGCTCATCCGCTCCTGGTCCCTGGCCACGTTCCGCACCCTGAAGCCAGAGGAGCAGCGCCAAGCCCTGCACAGCCTGGAGCTGCACTACCAGGCCTTCCTGCGGGACAGCCAGGACGCGGGCGGCTTCGGACCCGAGGACCGGCTGATGGCTGAGCGCGAGTACGGCTCCTGCAGCCACCACTACCAGCAGCTGCTGCAGAGCCTGGAACAGGGTGCACAGGAAGAGTCTCGCTGCCAGCGCTGCATCTCCGAGCTCAAAGACATCCGGCTGCAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGCCGCTGGACAAAGAGCCGGCACGGGAGTGTGCCCAGCGCATCGCCGAGCAGCAGAAGGCACAGGCAGAGGTGGAGGGGCTGGGCAAGGGGGTCGCCCGGCTCTCTGCCGAGGCCGAGAAGGTCTTGGCCCTACCAGAGCCATCGCCTGCGGCCCCCACGCTGCGCTCGGAGCTGGAGCTGACGCTGGGCAAGCTGGAGCAGGTCCGCAGCCTGTCTGCCATCTACCTGGAGAAGCTCAAGACCATCAGCCTGGTGATCCGCGGCACGCAGGGGGCCGAGGAGGTGCTCAGGGCCCACGAGGAGCAGCTCAAGGAGGCCCAGGCCGTGCCGGCCACCCTCCCGGAGCTCGAGGCCACCAAGGCCTCTCTGAAGAAGCTGCGGGCCCAGGCCGAGGCACAGCAGCCCACGTTCGACGCCCTGCGGGATGAGCTGCGGGGGGCACAGGAGGTGGGGGAGCGACTGCAGCAGCGGCACGGGGAGCGGGACGTGGAGGTGGAGCGCTGGCGGGAGCGGGTCGCCCAGTTGCTTGAGCGCTGGCAGGCTGTGCTGGCCCAGACCGACGTGCGGCAGCGCGAGCTCGAGCAACTGGGCCGCCAGCTGCGTTACTACCGCGAGAGTGCAGACCCCTTGGGCGCCTGGCTGCAGGACGCCAGGCGGCGGCAGGAGCAGATCCAGGCCATGCCGCTGGCCGACAGCCAGGCTGTGCGGGAGCAGCTGCGGCAGGAGCAGGCCCTGCTGGAGGAGATCGAGCGCCACGGCGAGAAGGTCGAGGAGTGCCAGAGGTTTGCGAAACAGTACATCAACGCCATCAAGGACTATGAACTCCAGCTGGTGACGTACAAGGCGCAGCTTGAGCCGGTGGCCTCCCCGGCCAAGAAGCCCAAGGTCCAGTCGGGATCAGAGAGTGTCATCCAGGAGTACGTGGACCTGCGTACGCACTACAGCGAGCTGACCACACTGACGAGCCAGTACATCAAGTTCATCAGCGAGACTCTGCGGCGCATGGAGGAGGAGGAGGTACAGCCCGTTGGGCGGAGGCTGGGCAGAGGGTTCCATCTCACCACCTGTTGTGTCCCAC