Transcript asmbl_137383

Sequence
Transcript Sequence for observation asmbl_137383 of TGE0059580:
GCCTGGGCAGTGCGGTGCGGGGCTGGACTCTGCCTGGTGGTGGCACAGCCGCCCTCAGCCCCGGCGCAGACATGGACCCCTCGCGAGCCATCCAGAACGAGATCAGCTCCCTCAAAGATGAGCGGGATCGTGTGCAGAAGAAAACCTTCACCAAGTGGGTCAACAAGCACCTCATCAAGGCCCAGAGGCACATCAGTGACCTGTATGAAGACCTCCGCGATGGCCACAACCTCATCTCCCTGCTGGAGGTCCTCTCGGGGGACAGCCTGCCCCGGGAGAAGGGGAGGATGCGTTTCCACAAGCTGCAGAATGTCCAGATTGCCCTGGACTACCTCCGGCACCGCCAGGTGAAGCTGGTGAACATCAGGAATGATGACATCGCTGACGGCAACCCCAAGCTGACCCTTGGCCTCATCTGGACAATCATTCTGCACTTCCAGATCTCAGATATCCAGGTGAGTGGGCAGTCGGAGGACATGACGGCCAAGGAGAAGCTGCTGCTGTGGTCGCAGCGAATGGTGGAGGGGTACCAGGGCCTGCGATGCGACAACTTCACCTCCAGCTGGAGAGACGGCCGCCTCTTCAATGCCATCATCCACCGGCACAAGCCCCTGCTCATCGACATGAACAAGGTGTACCGGCAGACCAACCTGGAGAACCTGGACCAGGCCTTCTCTGTGGCGGAGCGGGACCTGGGAGTGACGCGGCTCCTGGACCCTGAGGACGTGGATGTCCCTCAGCCCGACGAGAAGTCCATCATCACCTACGTCTCGTCGCTGTATGACGCCATGCCCCGCGTGCCGGACGTGCAGGATGGGGTGAGGGCCAACGAGCTGCAGCTGCGCTGGCAGGAGTACCGGGAGCTGGTGCTGCTGCTGCTTCAGTGGATGCGACACCACACGGCCGCCTTTGAGGAACGCAGGTTCCCCTCCAGCTTCGAGGAGATTGAGATCCTGTGGTCTCAGTTCCTGAAGTTTAAGGAGATGGAGCTACCAGCCAAGGAGGCCGACAAGAACAGGTCCAAGGGCATCTACCAATCCCTGGAGGGAGCGGTGCAAGCAGGCCAGCTCAAGGTGCCCCCTGGCTACCACCCGCTGGATGTGGAGAAGGAGTGGGGCAAGCTGCACGTGGCCATCCTGGAGCGGGAGAAGCAGCTCCGCAGCGAGTTTGAGAGGCTGGAGTGTCTTCAGCGCATCGTGACCAAGCTGCAGATGGAGGCGGGGCTGTGTGAGGAGCAGCTGAACCAGGCCGACGCCCTGCTGCAGTCGGATGTCCGGCTGCTGGCTGCAGGCAAAGTGCCACAGCGGGCGGGGGAGGTGGAACGGGACTTGGACAAGGCGGATAGCATGATCCGGCTGCTCTTCAACGACGTGCAGACCCTCAAGGATGGACGGCACCCGCAGGGCGAGCAGATGTACCGCAGGGTGTACCGTCTGCACGAGCGCCTGGTAGCCATCCGCACCGAGTACAACCTACGGCTGAAGGCAGGCGTGGCGGCCCCTGCAACCCAGGTGGCCCAGGTGACTCTGCAGAGTGTGCAGAGGCGCCCCGAGCTGGAGGACTCCACTCTGCGCTACCTGCAGGACCTGCTGGCCTGGGTGGAGGAGAACCAGCACCGTGTGGATGGCGCTGAGTGGGGTGTGGACCTGCCCAGCGTGGAGGCGCAGCTGGGCAGCCACCGAGGCCTGCACCAGTCCATCGAAGAATTCCGGGCCAAGATCGAGCGGGCACGGAGTGACGAGGGCCAGCTCTCCCCCGCCACCCGGGGTGCCTACCGTGACTGCCTGGGTCGGCTGGACCTGCAGTACGCCAAGCTGCTGAACTCCTCCAAGGCCCGCCTCAGGTCCCTGGAGAGCTTGCACAGCTTTGTGGCAGCCGCCACTAAGGAGCTAATGTGGCTGAATGAGAAGGAGGAGGAGGAGGTGGGCTTCGACTGGAGCGACCGCAACACCAACATGACCGCCAAGAAGGAGAGCTACTCGGCGCTGATGCGGGAGCTGGAGCTGAAGGAGAAGAAGATCAAGGAGCTCCAAAATGCTGGGGACCGGCTGCTGCGGGAGGACCACCCGGCCCGGCCCACGGTGGAGTCCTTCCAGGCGGCCCTGCAGACGCAGTGGAGCTGGATGCTACAGCTGTGCTGCTGTATCGAGGCACACCTGAAGGAGAACGCTGCCTACTTTCAGTTCTTCTCAGATGTGCGGGAGGCCGAGGGGCAGTTGCAGAAGCTGCAGGAGGCACTGCGTAGGAAATACAGTTGTGATCGCTCCGCCACCGTCACCCGGCTGGAGGACCTGCTGCAGGATGCCCAGGACGAGAAGGAACAGCTGAACGAGTACAAGGGCCACCTCTCAGGCCTGGCCAAGCGGGCCAAGGCCGTCGTGCAGCTGAAGCCCCGCCACCCAGCCCACCCCATGCGGGGCCGCCTGCCCCTGCTGGCCGTGTGCGACTATAAGCAGGTGGAGGTGACTGTGCACAAGGGTGACGAGTGCCAGCTGGTGGGCCCTGCACAGCCGTCCCACTGGAAGGTGCTCAGCAGCTCCGGCAGCGAGGCCGCCGTGCCCTCCGTGTGCTTCCTGGTGCCCCCGCCCAACCAGGAGGCCCAGGAGGCCGTCACCAGGCTGGAGGCCCAGCACCAGGCCCTGGTCACGCTGTGGCACCAGTTGCACGTGGACATGAAGAGCCTTCTGGCCTGGCAGAGCCTTCGCCGCGACGTGCAGCTCATCCGCTCCTGGTCCCTGGCCACGTTCCGCACCCTGAAGCCAGAGGAGCAGCGCCAAGCCCTGCACAGCCTGGAGCTGCACTACCAGGCCTTCCTGCGGGACAGCCAGGACGCGGGCGGCTTCGGACCCGAGGACCGGCTGATGGCTGAGCGCGAGTACGGCTCCTGCAGCCACCACTACCAGCAGCTGCTGCAGAGCCTGGAACAGGGTGCACAGGAAGAGTCTCGCTGCCAGCGCTGCATCTCCGAGCTCAAAGACATCCGGCTGCAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGCCGCTGGACAAAGAGCCGGCACGGGAGTGTGCCCAGCGCATCGCCGAGCAGCAGAAGGCACAGGCAGAGGTGGAGGGGCTGGGCAAGGGGGTCGCCCGGCTCTCTGCCGAGGCCGAGAAGGTCTTGGCCCTACCAGAGCCATCGCCTGCGGCCCCCACGCTGCGCTCGGAGCTGGAGCTGACGCTGGGCAAGCTGGAGCAGGTCCGCAGCCTGTCTGCCATCTACCTGGAGAAGCTCAAGACCATCAGCCTGGTGATCCGCGGCACGCAGGGGGCCGAGGAGGTGCTCAGGGCCCACGAGGAGCAGCTCAAGGAGGCCCAGGCCGTGCCGGCCACCCTCCCGGAGCTCGAGGCCACCAAGGCCTCTCTGAAGAAGCTGCGGGCCCAGGCCGAGGCACAGCAGCCCACGTTCGACGCCCTGCGGGATGAGCTGCGGGGGGCACAGGAGGTGGGGGAGCGACTGCAGCAGCGGCACGGGGAGCGGGACGTGGAGGTGGAGCGCTGGCGGGAGCGGGTCGCCCAGTTGCTTGAGCGCTGGCAGGCTGTGCTGGCCCAGACCGACGTGCGGCAGCGCGAGCTCGAGCAACTGGGCCGCCAGCTGCGTTACTACCGCGAGAGTGCAGACCCCTTGGGCGCCTGGCTGCAGGACGCCAGGCGGCGGCAGGAGCAGATCCAGGCCATGCCGCTGGCCGACAGCCAGGCTGTGCGGGAGCAGCTGCGGCAGGAGCAGGCCCTGCTGGAGGAGATCGAGCGCCACGGCGAGAAGGTCGAGGAGTGCCAGAGGTTTGCGAAACAGTACATCAACGCCATCAAGGACTATGAACTCCAGCTGGTGACGTACAAGGCGCAGCTTGAGCCGGTGGCCTCCCCGGCCAAGAAGCCCAAGGTCCAGTCGGGATCAGAGAGTGTCATCCAGGAGTACGTGGACCTGCGTACGCACTACAGCGAGCTGACCACACTGACGAGCCAGTACATCAAGTTCATCAGCGAGACTCTGCGGCGCATGGAGGAGGAGGAGGTACAGCCCGTTGGGCGGAGGCTGGGCAGAGGGTTCCATCTCACCACCTGTTGTGTCCCAC