Transcript asmbl_137380

Sequence
Transcript Sequence for observation asmbl_137380 of TGE0059577:
CCCACCCAACACGGAGTGGGCCGACAGGCGCCCGCGAGGCTGACGGGGGCCTCCGAGCGTCAGATGTCGGGCCTGGAAGGGCGAGGAACTCTGCGCTCTGGGGAAGATGAGCGGGATCGTGTGCAGAAGAAAACCTTCACCAAGTGGGTCAACAAGCACCTCATCAAGGCCCAGAGGCACATCAGTGACCTGTATGAAGACCTCCGCGATGGCCACAACCTCATCTCCCTGCTGGAGGTCCTCTCGGGGGACAGCCTGCCCCGGGAGAAGGGGAGGATGCGTTTCCACAAGCTGCAGAATGTCCAGATTGCCCTGGACTACCTCCGGCACCGCCAGGTGAAGCTGGTGAACATCAGGAATGATGACATCGCTGACGGCAACCCCAAGCTGACCCTTGGCCTCATCTGGACAATCATTCTGCACTTCCAGATCTCAGATATCCAGGTGAGTGGGCAGTCGGAGGACATGACGGCCAAGGAGAAGCTGCTGCTGTGGTCGCAGCGAATGGTGGAGGGGTACCAGGGCCTGCGATGCGACAACTTCACCTCCAGCTGGAGAGACGGCCGCCTCTTCAATGCCATCATCCACCGGCACAAGCCCCTGCTCATCGACATGAACAAGGTGTACCGGCAGACCAACCTGGAGAACCTGGACCAGGCCTTCTCTGTGGCGGAGCGGGACCTGGGAGTGACGCGGCTCCTGGACCCTGAGGACGTGGATGTCCCTCAGCCCGACGAGAAGTCCATCATCACCTACGTCTCGTCGCTGTATGACGCCATGCCCCGCGTGCCGGACGTGCAGGATGGGGTGAGGGCCAACGAGCTGCAGCTGCGCTGGCAGGAGTACCGGGAGCTGGTGCTGCTGCTGCTTCAGTGGATGCGACACCACACGGCCGCCTTTGAGGAACGCAGGTTCCCCTCCAGCTTCGAGGAGATTGAGATCCTGTGGTCTCAGTTCCTGAAGTTTAAGGAGATGGAGCTACCAGCCAAGGAGGCCGACAAGAACAGGTCCAAGGGCATCTACCAATCCCTGGAGGGAGCGGTGCAAGCAGGCCAGCTCAAGGTGCCCCCTGGCTACCACCCGCTGGATGTGGAGAAGGAGTGGGGCAAGCTGCACGTGGCCATCCTGGAGCGGGAGAAGCAGCTCCGCAGCGAGTTTGAGAGGCTGGAGTGTCTTCAGCGCATCGTGACCAAGCTGCAGATGGAGGCGGGGCTGTGTGAGGAGCAGCTGAACCAGGCCGACGCCCTGCTGCAGTCGGATGTCCGGCTGCTGGCTGCAGGCAAAGTGCCACAGCGGGCGGGGGAGGTGGAACGGGACTTGGACAAGGCGGATAGCATGATCCGGCTGCTCTTCAACGACGTGCAGACCCTCAAGGATGGACGGCACCCGCAGGGCGAGCAGATGTACCGCAGGGTGTACCGTCTGCACGAGCGCCTGGTAGCCATCCGCACCGAGTACAACCTACGGCTGAAGGCAGGCGTGGCGGCCCCTGCAACCCAGGTGGCCCAGGTGACTCTGCAGAGTGTGCAGAGGCGCCCCGAGCTGGAGGACTCCACTCTGCGCTACCTGCAGGACCTGCTGGCCTGGGTGGAGGAGAACCAGCACCGTGTGGATGGCGCTGAGTGGGGTGTGGACCTGCCCAGCGTGGAGGCGCAGCTGGGCAGCCACCGAGGCCTGCACCAGTCCATCGAAGAATTCCGGGCCAAGATCGAGCGGGCACGGAGTGACGAGGGCCAGCTCTCCCCCGCCACCCGGGGTGCCTACCGTGACTGCCTGGGTCGGCTGGACCTGCAGTACGCCAAGCTGCTGAACTCCTCCAAGGCCCGCCTCAGGTCCCTGGAGAGCTTGCACAGCTTTGTGGCAGCCGCCACTAAGGAGCTAATGTGGCTGAATGAGAAGGAGGAGGAGGAGGTGGGCTTCGACTGGAGCGACCGCAACACCAACATGACCGCCAAGAAGGAGAGCTACTCGGCGCTGATGCGGGAGCTGGAGCTGAAGGAGAAGAAGATCAAGGAGCTCCAAAATGCTGGGGACCGGCTGCTGCGGGAGGACCACCCGGCCCGGCCCACGGTGGAGTCCTTCCAGGCGGCCCTGCAGACGCAGTGGAGCTGGATGCTACAGCTGTGCTGCTGTATCGAGGCACACCTGAAGGAGAACGCTGCCTACTTTCAGTTCTTCTCAGATGTGCGGGAGGCCGAGGGGCAGTTGCAGAAGCTGCAGGAGGCACTGCGTAGGAAATACAGTTGTGATCGCTCCGCCACCGTCACCCGGCTGGAGGACCTGCTGCAGGATGCCCAGGACGAGAAGGAACAGCTGAACGAGTACAAGGGCCACCTCTCAGGCCTGGCCAAGCGGGCCAAGGCCGTCGTGCAGCTGAAGCCCCGCCACCCAGCCCACCCCATGCGGGGCCGCCTGCCCCTGCTGGCCGTGTGCGACTATAAGCAGGTGGAGGTGACTGTGCACAAGGGTGACGAGTGCCAGCTGGTGGGCCCTGCACAGCCGTCCCACTGGAAGGTGCTCAGCAGCTCCGGCAGCGAGGCCGCCGTGCCCTCCGTGTGCTTCCTGGTGCCCCCGCCCAACCAGGAGGCCCAGGAGGCCGTCACCAGGCTGGAGGCCCAGCACCAGGCCCTGGTCACGCTGTGGCACCAGTTGCACGTGGACATGAAGAGCCTTCTGGCCTGGCAGAGCCTTCGCCGCGACGTGCAGCTCATCCGCTCCTGGTCCCTGGCCACGTTCCGCACCCTGAAGCCAGAGGAGCAGCGCCAAGCCCTGCACAGCCTGGAGCTGCACTACCAGGCCTTCCTGCGGGACAGCCAGGACGCGGGCGGCTTCGGACCCGAGGACCGGCTGATGGCTGAGCGCGAGTACGGCTCCTGCAGCCACCACTACCAGCAGCTGCTGCAGAGCCTGGAACAGGGTGCACAGGAAGAGTCTCGCTGCCAGCGCTGCATCTCCGAGCTCAAAGACATCCGGCTGCAGCTGGAGGCCTGTGAGACGCGCACCGTGCACCGCCTGCGGCTGCCGCTGGACAAAGAGCCGGCACGGGAGTGTGCCCAGCGCATCGCCGAGCAGCAGAAGGCACAGGCAGAGGTGGAGGGGCTGGGCAAGGGGGTCGCCCGGCTCTCTGCCGAGGCCGAGAAGGTCTTGGCCCTACCAGAGCCATCGCCTGCGGCCCCCACGCTGCGCTCGGAGCTGGAGCTGACGCTGGGCAAGCTGGAGCAGGTCCGCAGCCTGTCTGCCATCTACCTGGAGAAGCTCAAGACCATCAGCCTGGTGATCCGCGGCACGCAGGGGGCCGAGGAGGTGCTCAGGGCCCACGAGGAGCAGCTCAAGGAGGCCCAGGCCGTGCCGGCCACCCTCCCGGAGCTCGAGGCCACCAAGGCCTCTCTGAAGAAGCTGCGGGCCCAGGCCGAGGCACAGCAGCCCACGTTCGACGCCCTGCGGGATGAGCTGCGGGGGGCACAGGAGGTGGGGGAGCGACTGCAGCAGCGGCACGGGGAGCGGGACGTGGAGGTGGAGCGCTGGCGGGAGCGGGTCGCCCAGTTGCTTGAGCGCTGGCAGGCTGTGCTGGCCCAGACCGACGTGCGGCAGCGCGAGCTCGAGCAACTGGGCCGCCAGCTGCGTTACTACCGCGAGAGTGCAGACCCCTTGGGCGCCTGGCTGCAGGACGCCAGGCGGCGGCAGGAGCAGATCCAGGCCATGCCGCTGGCCGACAGCCAGGCTGTGCGGGAGCAGCTGCGGCAGGAGCAGGCCCTGCTGGAGGAGATCGAGCGCCACGGCGAGAAGGTCGAGGAGTGCCAGAGGTTTGCGAAACAGTACATCAACGCCATCAAGGACTATGAACTCCAGCTGGTGACGTACAAGGCGCAGCTTGAGCCGGTGGCCTCCCCGGCCAAGAAGCCCAAGGTCCAGTCGGGATCAGAGAGTGTCATCCAGGAGTACGTGGACCTGCGTACGCACTACAGCGAGCTGACCACACTGACGAGCCAGTACATCAAGTTCATCAGCGAGACTCTGCGGCGCATGGAGGAGGAGGAGGTACAGCCCGTTGGGCGGAGGCTGGGCAGAGGGTTCCATCTCACCACCTGTTGTGTCCCAC