Transcript asmbl_136837

Sequence
Transcript Sequence for observation asmbl_136837 of TGE0056440:
CAGGAACACTGGCAGGGCAGCCTGCTGTCGGCTTAGAGGGGATGGGCAGTGTGGAGGGCCTGGCAGAGCAAGAGGACTCATCCTTCCAAAGGGACTTTCTCTGGGAAGCCTGCTCCTCGGGCCACTGCGAACCCTCTCTACTCTCCGAAGGGAATTGTCCTTCCTGGCTTCCACTACTTCCACCCCTGAATGCACAGGCAGCCCGGCCCAAGTCTCCCACTAGGGATGCAGATGGATTCGGTGTGAAGGGCTGGCTGCTGTTGCCTCCGGCTCTTGAAAGTCAAGTTCAGAGGCGTGCAAAGACTCCAGAATTGGAGGCATGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCAGACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGACGAGCTCTTCCAGGACAGGTTCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCCTTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCCCTTCCTTGAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAGCACCCGCCAACAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATCCGCCACAACTCCACGGGCTGCCTGCGGATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCTGCGGCGGGAGCTCGACGAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCCGGCTGGCAAACCTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACGGTGGCTTCCCACACTTCTGACTCGGACGTTCCTTCCGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGAAGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAGGAGTGAGATGTGGATGTTGCTTTTGCACCTACGGGGGCATCTGAGTCCAGCTCCCCCCAAGATGAGCTGCAGCCCCCCAGAGAGAGCTCTGCACGTCACCAAGTAACCAGGCCCCAGCCTCCAGGCCCCCAACTCCGCCCAGCCTCTCCCCGCTCTGGATCCTGCACTCTAACACTCGACTCTGCTGCTCATGGGAAGAACAGAATTGCTCCTGCATGCAACTAATTCAATAAAACTGTCTTGTGAGCTGATCGCTTGGAGGGTCCTCTTTTTATGTTGAGTTGCTGCTTCCCGGCATGCCTTCATTTTGCTATGGGGGGCAGGCAGGGGGGATGGAAAATAAGTAGAAACAAAAAAGCAGTGGCTAAGATGGTATAGGGACTGTCATACCAGTGAAGAATAAAAGGGTGAAGAATAAAAGGGATATGATGACAAGGTTGATCCACTTCAAGAATTGCTTGCTTTCAGGAAGAGAGATGTGTTTCAACAAGCCAACTAAAATATATTGCTGCAAATGGAAGCTTTTCTGTTCTATTATAAAACTGTCGATGTATTCTGACCAAGGTGCGACAATCTCCTAAAGGAATACACTGAAAGTTAAGGAGAAGAATCAGTAAGTGTAAGGTGTACTTGGTATTATAATGCATAATTGATGTTTTCGTTATGAAAACATTTGGTGCCCAGAA