Transcript asmbl_136498

Sequence
Transcript Sequence for observation asmbl_136498 of TGE0059572:
GCCGCACGCGGAGGATCCTAAGGAGCAGCTCTGTTGCGACATAGGCCGAGCAGCGAGGCCCAGCTCCCTGAAACAACAGTAACCTACCCCTGTGGGTCATCATCATGCCCTCCGACCTGGCCAAGAAGAAGGCAGCCAAAAAGAAGGAGGCTGCCAAAGCTCGACAGCGGCCCAGAAAAGGACATGAAGAAAATGGAGATGTTGTCACAGAACCACAGGTGGCAGAGAAGAATGAGGCCAATGGCAGAGAGACCACAGAAGTAGATTTGCTGACCAAGGAGCTAGAGGACTTTGAGATGAAGAAAGCTGCTGCTCGAGCTGTCACTGGCGTCCTGGCCTCTCACCCCAACAGTACTGATGTTCACATCATCAACCTCTCACTTACCTTTCATGGTCAAGAGCTGCTCAGTGACACCAAACTGGAATTAAACTCAGGCCGTCGTTATGGCCTCATTGGTTTAAATGGAATTGGAAAGTCCATGCTGCTCTCTGCTATTGGGAAGCGTGAAGTGCCCATCCCTGAGCACATCGACATCTACCATCTGACTCGAGAGATGCCCCCTAGTGACAAGACACCCTTGCATTGTGTGATGGAAGTCGACACAGAGCGGGCCATGCTGGAGAAAGAGGCAGAGCGGCTGGCTCATGAGGATGCGGAGTGTGAGAAGCTCATGGAGCTCTACGAGCGCCTGGAGGAGCTGGATGCCGACAAGGCAGAGATGAGGGCCTCGCGGATCTTGCATGGACTGGGTTTCACACCTGCCATGCAGCGCAAGAAGCTAAAAGACTTCAGTGGGGGCTGGAGGATGAGGGTTGCCCTTGCCAGAGCCCTCTTTATTCGGCCCTTCATGCTGCTCCTGGATGAGCCTACCAACCACCTGGACCTAGATGCTTGCGTGTGGTTGGAAGAAGAACTAAAAACTTTTAAGCGCATCTTGGTCCTCGTCTCCCATTCCCAGGATTTTCTGAATGGTGTCTGTACCAATATCATTCACATGCACAACAAGAAACTGAAGTATTATACGGGTAATTATGATCAGTACGTGAAGACGCGGCTAGAGCTGGAGGAGAACCAGATGAAGAGGTTTCACTGGGAGCAAGATCAGATTGCACACATGAAGAACTACATTGCGAGGTTTGGTCATGGCAGTGCCAAGCTGGCCCGGCAGGCCCAGAGCAAGGAGAAGACGCTACAGAAAATGATGGCATCAGGACTGACAGAGAGGGTCGTGAGCGATAAGACACTGTCATTTTATTTCCCACCATGTGGCAAGATCCCTCCACCTGTCATTATGGTGCAAAATGTGAGCTTCAAGTATACAAAAGATGGGCCTTGCATCTACAATAATCTAGAATTTGGAATTGACCTTGACACACGAGTGGCTCTGGTAGGGCCCAATGGAGCAGGGAAGTCAACTCTTCTGAAGCTGCTAACTGGAGAGCTACTACCCACAGATGGCATGATCCGAAAACACTCTCATGTCAAGATAGGGCGTTACCATCAGCATTTACAAGAGCAGCTGGACTTAGATCTCTCACCTTTGGAGTACATGATGAAGTGCTACCCAGAGATCAAGGAGAAGGAAGAAATGAGGAAGATCATTGGGCGATACGGTCTCACTGGGAAACAACAGGTGAGCCCAATCCGGAACTTGTCAGACGGGCAGAAGTGCCGAGTGTGTCTGGCCTGGCTGGCCTGGCAGAACCCCCACATGCTCTTCCTGGATGAACCCACCAATCACCTGGATATCGAGACCATCGACGCCCTGGCAGATGCCATCAATGAGTTTGAGGGTGGTATGATGCTGGTCAGCCATGACTTCAGACTCATTCAGCAGGTTGCACAGGAAATTTGGGTCTGTGAGAAGCAGACAATCACCAAGTGGCCTGGAGACATCCTGGCTTACAAGGAGCACCTCAAGTCCAAGCTGGTGGATGAGGAGCCCCAGCTCACCAAGAGGACCCACAACGTGTGCACCCTGACATTGGCATCTCTGCCAAGGCCATGAGCATCATGAACTCGTTTGTAAACGACGTGTTTGAGCAGCTGGCGTGTGAGGCTGCCCGGCTGGCCCAGTACTCGGGCCGGACCACCCTGACATCCCGAGAAGTCCAGACGGCTGTGCGTCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCTGTGTCTGAGGGCACCAAGGCTGTCACCAAGTACAC