Transcript asmbl_136237

Sequence
Transcript Sequence for observation asmbl_136237 of TGE0059402:
AAACAGCAGGACCTGGCGCTTCCCTGGAATGGAGAAGCCTTGAAACCACTCCAGAGCCCCAGGGACTGTCCATGGGCTCCCCTAGCTCCGGAAAGCGGCGTCCACCGCGAGCCCCGGCGCCTCGTCCCCAGCGAAGCGCCGGTGACCCTCGCGCGTGCACGCACACGCACTCTCGCTTCCCAAGCTCACAGATCTCCACGCGCACACTCACACCGAGGATGCGCGGGCTGCCGCGTGCACGCGGGTTCACGTGCGTGGCCCTGTGCAGAGCCCGAGTGCGCGCTCAGGAACCCGAGTTCAGCTACGGCTGCGCAGAAGGCAGCTGCTATCCCGCCACGGGCGACCTTCTCATCGGCCGAGCACAGAAGCTTTCGGTGACCTCGACGTGCGGGCTGCACAAGCCCGAACCCTACTGTATCGTCAGCCACTTGCAGGAGGACAAAAAATGCTTCATATGCAATTCCCAAGATCCTTATCATGAGACCCTGAATCCTGACAGCCATCTCATTGAAAATGTGGTCACTACATTTGCTCCAAACCGCCTTAAGATTTGGTGGCAATCTGAAAATGGTGTGGAAAATGTAACTATCCAACTGGATTTGGAAGCAGAATTCCATTTTACTCATCTCATAATGACTTTCAAGACATTCCGTCCAGCTGCTATGCTGATAGAACGATCGTCCGACTTTGGGAAAACCTGGGGTGTGTATAGATACTTCGCCTATGACTGTGAGGCCTCGTTTCCAGGCATTTCAACTGGCCCCATGAAAAAAGTCGATGACATAATTTGTGATTCTCGATATTCTGACATTGAACCCTCAACTGAAGGAGAGGTGATATTTCGTGCTTTAGATCCTGCTTTCAAAATAGAAGATCCTTATAGCCCAAGGATACAGAATTTATTAAAAATTACCAACTTGAGAATCAAGTTTGTGAAACTGCATACTTTGGGAGATAACCTTCTGGATTCCAGGATGGAAATCAGAGAAAAGTATTATTATGCAGTTTATGATATGGTGGTTCGAGGAAATTGCTTCTGCTATGGTCATGCCAGCGAATGTGCCCCTGTGGATGGATTCAATGAAGAAGTGGAAGGAATGGTTCACGGACACTGCATGTGCAGGCATAACACCAAGGGCTTAAACTGTGAACTCTGCATGGATTTCTACCATGATTTACCTTGGAGACCTGCTGAAGGCCGAAACAGCAACGCCTGTAAAAAATGTAACTGCAATGAACATTCCATCTCTTGTCACTTTGACATGGCTGTTTACCTGGCCACGGGGAACGTCAGCGGAGGCGTGTGTGATGACTGTCAGCACAACACCATGGGGCGCAACTGTGAGCAGTGCAAGCCGTTTTACTACCAGCACCCAGAGAGGGACATCCGAGATCCTAATTTCTGTGAACGATGTACGTGTGACCCAGCTGGCTCTCAAAATGAGGGAATTTGTGACAGCTATACTGATTTTTCTACTGGTCTCATTGCTGGCCAGTGTCGGTGTAAATTAAATGTGGAAGGAGAACATTGTGATGTTTGCAAAGAAGGCTTCTATGATTTAAGCAGTGAAGATCCATTTGGTTGTAAATCTTGTGCTTGCAATCCTCTGGGAACAATTCCTGGAGGGAATCCTTGTGATTCCGAGACAGGTCACTGCTACTGCAAGCGTCTGGTGACAGGACAGCATTGTGACCAGTGCCTGCCAGAGCACTGGGGCTTAAGCAATGATTTGGATGGATGTCGACCATGTGACTGTGACCTTGGGGGAGCCTTAAACAACAGTTGCTTTGCGGAGTCAGGCCAGTGCTCATGCCGGCCTCACATGATTGGACGTCAGTGCAACGAAGTGGAACCTGGTTACTACTTTGCCACCCTGGATCACTACCTCTATGAAGCGGAGGAAGCCAACTTGGGGCCTGGGGTTAGCATAGTGGAGCGGCAATATATCCAGGACCGGATTCCCTCCTGGACTGGAGCCGGCTTCGTCCGAGTGCCTGAAGGGGCTTATTTGGAGTTTTTCATTGACAACATACCATATTCCATGGAGTACGACATCCTAATTCGCTACGAGCCACAGCTACCCGACCACTGGGAAAAAGCTGTCATCACAGTGCAGCGACCTGGAAGGATTCCAACCAGCAGCCGATGTGGTAATACCATCCCCGATGATGACAACCAGGTGGTGTCATTATCACCAGGCTCAAGATATGTCGTCCTTCCTCGGCCGGTGTGCTTTGAGAAGGGAACAAACTACACGGTGAGGTTGGAGCTGCCTCAGTACACCTCCTCTGATAGCGACGTGGAGAGCCCCTACACGCTGATCGATTCTCTTGTTCTCATGCCATACTGTAAATCACTGGACATCTTCACCGTGGGAGGTTCAGGAGATGGGGTGGTCACCAACAGTGCCTGGGAAACCTTTCAGAGATACCGATGTCTAGAGAACAGCAGAAGCGTTGTGAAAACACCGATGACAGATGTTTGCAGAAACATCATCTTTAGCATTTCTGCCCTGTTACACCAGACAGGCCTGGCTTGTGAATGCGACCCTCAGGGTTCGTTAAGTTCCGTGTGTGATCCCAACGGAGGCCAGTGCCAGTGCCGGCCCAACGTGGTTGGAAGAACCTGCAACAGATGTGCACCTGGAACTTTTGGCTTTGGCCCCAGTGGATGCAAACCTTGTGAGTGCCATCTGCAAGGATCTGTCAATGCCTTCTGCAATCCCGTCACTGGCCAGTGCCACTGTTTCCAGGGAGTGTATGCTCGGCAGTGTGATCGGTGCTTACCTGGGCACTGGGGCTTTCCAAGTTGCCAGCCCTGCCAGTGCAATGGCCACGCCGATGACTGCGACCCAGTGACTGGGGAGTGCTTGAACTGCCAGGACTACACCATGGGTCATAACTGTGAAAGGTGCTTGGCTGGTTACTATGGCGACCCCATCATTGGGTCAGGAGATCACTGCCGCCCTTGCCCTTGCCCAGATGGTCCCGACAGTGGACGCCAGTTTGCCAGGAGCTGCTACCAAGATCCTGTTACTTTACAGCTTGCCTGTGTTTGTGATCCTGGATACATTGGTTCCAGATGTGACGACTGTGCCTCAGGATACTTTGGCAATCCATCAGAAGTTGGGGGGTCGTGTCAGCCTTGCCAGTGTCACAACAACATTGACACGACAGACCCAGAAGCCTGTGACAAGGAGACTGGGAGGTGTCTCAAGTGCCTGTACCACACGGAAGGGGAACACTGTCAGTTCTGCCGGTTTGGATACTATGGTGATGCCCTCCAGCAGGACTGTCGAAAGTGTGTCTGTAATTACCTGGGCACCGTGCAAGAGCACTGTAACGGCTCTGACTGCCAGTGCGACAAAGCCACTGGTCAGTGCTTGTGTCTTCCTAATGTGATCGGGCAGAACTGTGACCGCTGTGCGCCCAATACCTGGCAGCTGGCCAGTGGCACTGGCTGTGACCCATGCAACTGCAATGCTGCTCATTCCTTCGGGCCATCTTGCAATGAGTTCACGGGGCAGTGCCAGTGCATGCCTGGGTTTGGAGGCCGCACCTGCAGCGAGTGCCAGGAACTCTTCTGGGGAGACCCCGACGTGGAGTGCCGAGCCTGTGACTGTGACCCCAGGGGCATTGAGACGCCACAGTGTGACCAGTCCACGGGCCAGTGTGTCTGCGTTGAGGGTGTTGAGGGTCCACGCTGTGACAAGTGCACGCGAGGGTACTCGGGGGTCTTCCCTGACTGCACACCCTGCCACCAGTGCTTTGCTCTCTGGGATGTGATCATTGCCGAGCTGACCAACAGGACACACAGATTCCTGGAGAAAGCCAAGGCCTTGAAGATCAGTGGTGTGATCGGGCCTTACCGTGAGACTGTGGACTCGGTGGAGAGGAAAGTCAGCGAGATAAAAGACATCCTGGCGCAGAGCCCCGCAGCAGAGCCACTGAAAAACATTGGGAATCTCTTTGAGGAAGCAGAGAAACTGATTAAAGATGTTACAGAAATGATGGCTCAAGTAGAAGTGAAATTATCTGACACAACTTCCCAAAGCAACAGCACAGCCAAAGAACTGGATTCTCTACAGACAGAAGCCGAAAGCCTAGACAACACTGTGAAAGAACTTGCTGAACAACTGGAATTTATCAAAAACTCAGATATTCGGGGTGCCTTGGATAGCATTACCAAGTATTTCCAGATGTCTCTTGAGGCAGAGGAGAGGGTGAATGCCTCCACCACAGAACCCAACAGCACTGTGGAGCAGTCAGCCCTCATGAGAGACAGAGTAGAAGACGTGATGATGGAGCGAGAATCCCAGTTCAAGGAAAAACAAGAGGAGCAGGCTCGCCTCCTTGATGAACTGGCAGGCAAGCTACAAAGCCTAGACCTTTCAGCCGCTGCCGAAATGACCTGTGGAACACCCCCAGGGGCCTCCTGTTCCGAGACTGAATGTGGCGGGCCAAACTGCAGAACTGACGAAGGAGAGAGGAAGTGTGGGGGGCCTGGCTGTGGTGGTCTGGTTACTGTTGCACACAACGCCTGGCAGAAAGCCATGGACTTGGACCAAGATGTCCTGAGTGCCCTGGCTGAAGTGGAACAGCTCTCCAAGATGGTCTCTGAAGCAAAACTGAGGGCAGATGAGGCAAAACAAAGTGCTGAAGACATTCTGTTGAAGACAAATGCTACCAAAGAAAAAATGGACAAGAGCAATGAGGAGCTGAGAAATCTAATCAAGCAAATCAGAAACTTTTTGACCCAGGATAGTGCTGATTTGGACAGCATTGAAGCAGTTGCTAATGAAGTATTGAAAATGGAGATGCCTAGCACCCCACAGCAGTTACAGAACTTGACAGAAGATATACGTGAACGAGTTGAAAGCCTTTCTCAAGTAGAGGTTATTCTTCAGCATAGTGCTGCTGACATTGCCAGAGCTGAGATGTTGTTAGAAGAAGCTAAAAGAGCAAGCAAAAGTGCAACAGATGTTAAAGTCACTGCAGATATGGTAAAGGAAGCTCTGGAAGAAGCAGAAAAGGCCCAGGTCGCAGCAGAGAAGGCAATTAAACAAGCAGATGAAGACATTCAAGGAACCCAGAACCTGTTAACTTCGATTGAGTCTGAAACAGCAGCTTCTGAGGAAACCTTGTTCAACGCGTCCCAGCGCATCAGCGAGTTAGAGAGGAATGTGGAAGAACTTAAGCGGAAAGCTGCCCAAAACTCCGGGGAGGCAGAATATATTGAAAAAGTAGTATATACTGTGAAGCAAAGTGCAGAAGATGTTAAGAAGACTTTAGATGGTGAACTTGATGAAAAGTATAAAAAAGTAGAAAATTTAATTGCCAAAAAAACTGAAGAGTCAGCTGATGCCAGAAGGAAAGCCGAAATGCTACAAAATGAAGCAAAAACTCTTTTAGCTCAAGCAAATAGCAAGCTGCAACTGCTCAAAGATTTAGAAAGAAAATATGAAGACAATCAAAGATACTTAGAAGATAAAGCTCAAGAATTAGCAAGACTGGAAGGAGAAGTCCGTTCACTCCTAAAGGATATAAGCCAGAAAGTTGCTGTGTATAGCACATGCTTGTAACAGAGGAGAATAAAAAATGGCTGAGGTGAACAAGGTAAAACAACTACATTTTAAAAACTGACTTAATGCTCTTCAAAATAAAACATCACCTATTTAATGTTTTTAATCACATTTTGTATGGAGTTAAATAAAGTACAGTGCTTTTGTAT