Transcript asmbl_136099

Sequence
Transcript Sequence for observation asmbl_136099 of TGE0059570:
CCAGGCACCTCGCCCTTCGCTTCATGGCCTTCTAGTAGTTCCAGGGTGTTCGCAGTTGTGACCTGCTTCCCGTGAGCCTCTGCTCTACGCCCCTGGATGGGGCGTGCATTCCCTACCCAGCAGCCCTCGCGCGGTCCGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATTTTCGGAGCGTTTCAAAGAGGTTACTACCGGTACTACAACAAGTACATCAATGTGAAGAAGGGGAGCATCTCGGGGATTACCATGGTGCTGGCATGCTACGTGCTCTTTAGCTACTCCTTTTCCTACAAGCATCTCAAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGGCCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAACATGACTGGTACGTGTGCTG