Transcript asmbl_136098

Sequence
Transcript Sequence for observation asmbl_136098 of TGE0059569:
CCAGGCACCTCGCCCTTCGCTTCATGGCCTTCTAGTAGTTCCAGGGTGTTCGCAGTTGTGACCTGCTTCCCGTGAGCCTCTGCTCTACGCCCCTGGATGGGGCGTGCATTCCCTACCCAGCAGCCCTCGCGCGGTCCGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATTTTCGGAGCGTTTCAAAGAGGTTACTACCGGTACTACAACAAGTACATCAATGTGAAGAAGGGGAGCATCTCGGGGATTACCATGGTGCTGGCATGCTACGTGCTCTTTAGCTACTCCTTTTCCTACAAGCATCTCAAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGGCCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAACATGACTGGTACGTGTGCTG