Transcript asmbl_136097

Sequence
Transcript Sequence for observation asmbl_136097 of TGE0059568:
CCAGGCACCTCGCCCTTCGCTTCATGGCCTTCTAGTAGTTCCAGGGTGTTCGCAGTTGTGACCTGCTTCCCGTGAGCCTCTGCTCTACGCCCCTGGATGGGGCGTGCATTCCCTACCCAGCAGCCCTCGCGCGGTCCGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATTTTCGGAGCGTTTCAAAGAGAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGGCCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAACATGACTGGTACGTGTGCTG