Transcript asmbl_136096

Sequence
Transcript Sequence for observation asmbl_136096 of TGE0059567:
CCAGGCACCTCGCCCTTCGCTTCATGGCCTTCTAGTAGTTCCAGGGTGTTCGCAGTTGTGACCTGCTTCCCGTGAGCCTCTGCTCTACGCCCCTGGATGGGGCGTGCATTCCCTACCCAGCAGCCCTCGCGCGGTCCGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATTTTCGGAGCGTTTCAAAGAGAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGGCCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAACATGACTGGTACGTGTGCTG