Transcript asmbl_136066

Sequence
Transcript Sequence for observation asmbl_136066 of TGE0002687:
AACGCACGCTGCCTGGCCGTATCGCCGCCCCCACCGCCGCCGCCGCCGGGACTAGAAGTGAGCCGCCCGGGTCCCAAACGCCAGCCAGCCAGTCAGTGGGTCCCGCAGTCGCCCGCAACCGGGGCGAATCATGGCGGCCGCCAAGGTGGCTTTAACCAAGAGAGCAGATCCAGCTGAGCTTAGAACAATATTTTTGAAGTATGCAAGCATTGAGAAAAACGGTGAATTTTTCATGTCCCCCAATGACTTTGTCACTCGATACTTGAACATTTTTGGAGAAAGCCAGCCTAATCCAAAGACTGTGGAACTTTTAAGTGGAGTGGTGGATCAGACCAAAGATGGATTAATATCTTTTCAAGAATTTGTTGCCTTTGAATCTGTCCTGTGTGCCCCTGATGCTTTGTTTATGGTAGCCTTTCAGCTGTTTGACAAAGCTGGCAAAGGAGAAGTAACTTTTGAGGATGTTAAGCAAGTTTTTGGACAGACCACAATTCATCAACATATTCCATTTAACTGGGATTCAGAATTTGTGCAACTACATTTTGGAAAAGAAAGAAAAAGACACCTGACATATGCGGAATTTACTCAGTTTTTATTGGAAATACAACTGGAGCACGCAAAGCAAGCCTTTGTGCAACGGGACAATGCTAGGACTGGGAGAGTCACAGCCATCGACTTCCGAGACATCATGGTCACCATCCGCCCCCATGTCTTGACTCCTTTTGTAGAAGAATGTCTAGTAGCTGCTGCTGGAGGTACCACATCCCATCAAGTTAGTTTCTCCTATTTTAATGGATTTAATTCGCTCCTTAACAACATGGAACTCATTAGAAAGATCTATAGCACTCTGGCTGGCACCAGGAAAGATGTTGAAGTGACTAAGGAGGAGTTTGTTCTGGCAGCTCAGAAATTTGGTCAGGTTACACCCATGGAAGTTGACATCTTGTTTCAGTTAGCAGATTTATATGAGCCAAGGGGACGTATGACCTTAGCAGACATTGAACGGATTGCTCCTCTGGAAGAGGGAACTCTGCCCTTTAACTTGGCTGAGGCCCAGAGGCAGAAGGCCTCAGGTGATTCAGCTCGACCAGTTCTTCTACAAGTTGCAGAGTCGGCCTACAGGTTTGGTCTGGGTTCTGTTGCTGGAGCTGTTGGAGCCACTGCTGTGTATCCTATCGATCTTGTAAAAACTCGAATGCAGAACCAACGATCAACTGGCTCTTTTGTGGGAGAACTCATGTATAAAAACAGCTTTGACTGTTTTAAGAAAGTGCTACGCTATGAAGGCTTCTTTGGACTGTATAGAGGTCTGTTGCCACAGTTATTGGGAGTTGCCCCAGAGAAGGCCATAAAACTTACAGTGAACGATTTTGTGAGGGATAAATTTATGCACAAAGATGGTTCGGTCCCACTTGCAGCAGAAATTCTTGCTGGAGGCTGCGCTGGAGGCTCCCAGGTGATTTTCACAAATCCTTTAGAAATCGTCAAGATCCGTTTGCAAGTGGCAGGAGAAATCACCACTGGTCCTCGAGTCAGTGCTCTGTCTGTCGTGCGGGACCTGGGGTTTTTTGGGATCTACAAGGGTGCCAAAGCATGCTTTCTGCGGGACATTCCTTTCTCGGCCATCTACTTTCCGTGCTATGCTCATGTGAAGGCTTCCTTTGCAAATGAAGATGGGCAGGTTAGCCCAGGAAGCCTGCTCTTAGCTGGTGCCATAGCTGGTATGCCTGCAGCATCTTTAGTGACCCCTGCTGATGTTATCAAGACGAGATTACAGGTGGCTGCCCGGGCTGGCCAAACCACTTACAGCGGAGTGATAGACTGCTTTAGAAAGATACTGCGTGAAGAAGGACCAAAAGCTCTGTGGAAGGGAGCTGGTGCTCGTGTATTTCGATCCTCACCCCAGTTTGGTGTAACTTTGCTGACTTACGAATTGCTACAGCGATGGTTCTACATTGATTTTGGAGGAGTAAAACCCATGGGATCAGAGCCAGTTCCTAAATCCAGGATCAACCTGCCTGCCCCGAATCCTGATCACGTTGGGGGCTACAAACTGGCAGTTGCTACATTTGCAGGGATTGAAAACAAATTTGGACTTTACCTACCTCTCTTCAAGCCATCAGTATCTACCTCAAAGGCTATTGGTGGAGGCCCATAGGAAGATCAGCCCTGGGATAGTGCTGTCTTTTTGTGGGTACTGCAGTAAAGAACATCCCTCCTGGGAATGAAGCAATGCTTCATCCCTTTTACGTCCATCTCTTGTTTAAATTCAAGTCCAGGCTTTTTTATCATGTGAAATCATTCATTTTCTGGGTGTTTTCTTAACCAGATCATTGTGAAATTATTCATAATTATTATTTGGCCCTCTGCCCAGAAACCTTTGTTTGCATCTGAAAATTGATGGGATTTGGTCAACACTAACATGATTTGGGGAAAGGAGCAAGTCAGAATAGAAATTAGTACTCCCCTCCTTGAACTAGGATTGTAGTCCCAAAGAGGCTACTGTAAGGCAATCATGGTGCTCAGAGCAGTGTTTCGTGTGTGTTTTAAACTGGTAGGAAACTAGGTGCATATTTATAAAAATAAAAAACACTGGGAGAAATGAAAAAATATATATCAAATATATTCAGCCTGGCTTCAAATTGTAAGCATGCACAAATTCTGTCTCTGGATTATATTATGAAGCTTTTATGTGAAACATGTTTCTTTGTAATGAAAACCACATTGGAGATGTTTAGTAATCATATTGTTACTGGTACCAAGACTACTAGGGAAATGCCTTTGTACTTTAGGGAAGTACTTTTGGCATTTTACTGTACAGACAGAAAAAACTGAGATGTAGCCCCTCTCCTGGAAGTGCTAATTTTGAAAAACTGCTCATATGATGTACATGTACTGATTACTGCCTATTTTAATAAACACTCTTGAAAAATGCATGTTGCCCTGTTGCTGCCTGCCCTATTCTCCTCATCTCCCCATCATTGGTACCCACTTGCTTTTAAAATCCACTTTATCTTGAATAATGTAAGACAAATATGTTCTGACATAAGTATTTAATTCATGTTGCCTTGCATAATGGTCAGAGGCGCATGAATTTGTGAAGG