Transcript asmbl_135623

Sequence
Transcript Sequence for observation asmbl_135623 of TGE0059565:
GTTCTAGAAAAGCGGCGGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCAGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGTCCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAGAGAAAAGGAACAGTTCCGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGATCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCTGCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAGGAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAAGAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTTGATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCATAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAAGTTCAGAGTTCTAGGAGTGGAAGAGGAGGCAACTTTGGCTTTGGGGATTCACGTGGTGGCGGTGGAAATTTCGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGATATGGCAGTGGACGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCCGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTACAATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGAAGAGTGGAAACTTTGGTGGTAGCAGGAACATGGGGGGACCATATGGTGGAGGAAACTATGGTCCAGGAGGCAGTGGAGGAAGTGGGGGTTATGGTGGGAGGAGCCGATACTGAGCTTCTTCCTATTTGCCATGGGTAAGTAGCTTTTGAGTTTTACAATTATTATTATCTTGGGAGACATAGCTGCAGGAGTAAAAGCTTTTTAGGATCATGTTATCTTTCCTTAAAATCTGGTTAGATGGATAATTTCATAACCTATTTTTTTTTTACTCTTTACTTCTGTTGAAACAGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAATATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTTCCTTTAAAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCGTTGCAAAGCTGTTGTTATATTTGTATAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATGTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGACACAGGTCTAGTACAAGAGAACTCTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAACTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTTATTTACTTTTCCTTTCTTAATTTTCCTCCCTAAAAGATAAACTAATACTCTTAAATGGTCTTTCAGTATAGTGGTTCTTACGTAGTTTAACATAGCTATAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTTATAAACCCTGTTTTCCAATCTGTCATTTACTTAAATTATTTTGGTTGTTTTTCCCTTTTTTTCCTTCTTTTCCCACCCCCTCCCCCTCCATGTGAAGATTTGGGTGCTTAACATATCATTTTTTTCCCTGCCGGAATTTTAGCATTGATATGAACCATGGACAAGTATATTCTGCTGCCACAAAGACTGTAAAGTGCTTCATTTCAACAGCTGAGGCAAGCCAAGTGATCATTAATAAAGCTTTTCTTGGTTCCTTCAGTGGTGTTGGTAGTAAAATGGAAGGTGTCTTGCTGCAGGTAACTAATGAAGAAGTGGTCAACCACAGAGTCTTCAAGAAATAAGAAATTCTGTACCATCTGAAAGTAGTTCTTGTTGGTGCCTTCATTTAAAAAGCACTCTTTAAAATAAAAGGGAAATGTTTTCTGATAAAACAAACATTTAGTTGAGGTTCTTGATATAAAACAATTACAAAATGAGTGTTGTTTGTAAAACAGTAACATCAAATTGGCTAGAGAGATAAATGTATCATGTTTTAAATTAGGTTTTGTGAGTAGACAGATTACAATTCTATTTTAAATATAAAGTTTATAAAATAAATACTTTTTGTATCCAAATACTTGGTGTAATGTTTACACATAAAATGTGTGAATCTTGTTCTATAAATATTTGGTTGTCTAAAAGATCACCATCCCCTAAATTTTTAAAAGCAGTTTCACAAAGCTATGCATATTTTAATATTAACAGGTAAATGAGAAGAGCATTGTGGACATTATTGGCTGTCCCCAATAAAATGCTGTTCATTATGCACTGT