Transcript asmbl_135621

Sequence
Transcript Sequence for observation asmbl_135621 of TGE0059565:
GTTCTAGAAAAGCGGCGGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCAGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGTCCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAGAGAAAAGGAACAGTTCCGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGATCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCTGCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAGGAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAAGAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTTGATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCATAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAAGTTCAGAGTTCTAGGAGTGGAAGAGGAGGCAACTTTGGCTTTGGGGATTCACGTGGTGGCGGTGGAAATTTCGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGATATGGCAGTGGACGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCCGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTACAATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGAAGAGTGGAAACTTTGGTGGTAGCAGGAACATGGGGGGACCATATGGTGGAGGAAACTATGGTCCAGGAGGCAGTGGAGGAAGTGGGGGTTATGGTGGGAGGAGCCGATACTGAGCTTCTTCCTATTTGCCATGGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAATATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTTCCTTTAAAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCGTTGCAAAGCTGTTGTTATATTTGTATAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATGTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGACACAGGTCTAGTACAAGAGAACTCTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAACTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTTATTTACTTTTCCTTTCTTAATTTTCCTCCCTAAAAGATAAACTAATACTCTTAAATGGTCTTTCAGTATAGTGGTTCTTACGTAGTTTAACATAGCTATAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTTATAAACCCTGTTTTCCAATCTGTCATTTACTTAAATTATTTTGGTTGTTTTTCCCTTTTTTTCCTTCTTTTCCCACCCCCTCCCCCTCCATGTGAAGATTTGGGTGCTTAACATATCATTTTTTTCCCTGCCGGAATTTTAGCATTGATATGAACCATGGACAAGTATATTCTGCTGCCACAAAGACTGTAAAGTGCTTCATTTCAACAGCTGAGGCAAGCCAAGTGATCATTAATAAAGCTTTTCTTGGTTCCTTCAGTGGTGTTGGTAGTAAAATGGTAGGTAAAAGTTAGGCTGCAAGTTCAATAAATCATGAGATTTCCCATCGTTACACCCTTGTGTATTCACATTTCTTGGATCAAACATTTTGAGTGAACTAGGGGTTTTTATTAAAGACATTTGTTGTATTTATGGTTGTAACTGTACATGCTTATCAGGATGAGACTGAAAGAAGGTAGGGCAAAAATGGTTGAATCTATTTTCAGATAGTAGTTCATACTTGAGTGAAGTGTCTTGTCTGCATTATGAAGCCTGGTATGTATCCAGTACTAAATAGGTGGGTTAAATGTGGTAATTCTAGTTCAGTGTCTTACCCTGAAGAGAAAGTTGTAGGTTGGCTGTTGAAATTCATTCCTTAGATATGATCAGTTTGATTGCCCGGCTTTATTGCCTTTACAGGAATGTGATACTCAGGGCTTACTCTATACACCAATGAGTCTTCTTTGATCCTAAGACCACCACTGAAGTTGTTTAGGTTCTTTTGGACAAACATGATAAACTTCTTCAGATACTTTTTTTTTCCTTTGGCAGGAAGGTGTCTTGCTGCAGGTAACTAATGAAGAAGTGGTCAACCACAGAGTCTTCAAGAAATAAGAAATTCTGTACCATCTGAAAGTAGTTCTTGTTGGTGCCTTCATTTAAAAAGCACTCTTTAAAATAAAAGGGAAATGTTTTCTGATAAAACAAACATTTAGTTGAGGTTCTTGATATAAAACAATTACAAAATGAGTGTTGTTTGTAAAACAGTAACATCAAATTGGCTAGAGAGATAAATGTATCATGTTTTAAATTAGGTTTTGTGAGTAGACAGATTACAATTCTATTTTAAATATAAAGTTTATAAAATAAATACTTTTTGTATCCAAATACTTGGTGTAATGTTTACACATAAAATGTGTGAATCTTGTTCTATAAATATTTGGTTGTCTAAAAGATCACCATCCCCTAAATTTTTAAAAGCAGTTTCACAAAGCTATGCATATTTTAATATTAACAGGTAAATGAGAAGAGCATTGTGGACATTATTGGCTGTCCCCAATAAAATGCTGTTCATTATGCACTGT