Transcript asmbl_135616

Sequence
Transcript Sequence for observation asmbl_135616 of TGE0059565:
GTTCTAGAAAAGCGGCGGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGTTGTTTCTCGAGCAGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGTCCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAGAGAAAAGGAACAGTTCCGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGATCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCTGCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAGGAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAAGAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTTGATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCATAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAAGTTCAGAGTTCTAGGAGTGGAAGAGGAGGCAACTTTGGCTTTGGGGATTCACGTGGTGGCGGTGGAAATTTCGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGATATGGCAGTGGACGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCCGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTACAATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGAAGAGTGGAAACTTTGGTGGTAGCAGGAACATGGGGGGACCATATGGTGGAGGAAACTATGGTCCAGGAGGCAGTGGAGGAAGTGGGGGTTATGGTGGGAGGAGCCGATACTGAGCTTCTTCCTATTTGCCATGGGTAAGTAGCTTTTGAGTTTTACAATTATTATTATCTTGGGAGACATAGCTGCAGGAGTAAAAGCTTTTTAGGATCATGTTATCTTTCCTTAAAATCTGGTTAGATGGATAATTTCATAACCTATTTTTTTTTTACTCTTTACTTCTGTTGAAACAGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAATATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTTCCTTTAAAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCGTTGCAAAGCTGTTGTTATATTTGTATAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATGTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGACACAGGTCTAGTACAAGAGAACTCTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAACTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTTATTTACTTTTCCTTTCTTAATTTTCCTCCCTAAAAGATAAACTAATACTCTTAAATGGTCTTTCAGTATAGTGGTTCTTACGTAGTTTAACATAGCTATAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTTATAAACCCTGTTTTCCAATCTGTCATTTACTTAAATTATTTTGGTTGTTTTTCCCTTTTTTTCCTTCTTTTCCCACCCCCTCCCCCTCCATGTGAAGATTTGGGTGCTTAACATATCATTTTTTTCCCTGCCGGAATTTTAGCATTGATATGAACCATGGACAAGTATATTCTGCTGCCACAAAGACTGTAAAGTGCTTCATTTCAACAGCTGAGGCAAGCCAAGTGATCATTAATAAAGCTTTTCTTGGTTCCTTCAGTGGTGTTGGTAGTAAAATGGTAGGTAAAAGTTAGGCTGCAAGTTCAATAAATCATGAGATTTCCCATCGTTACACCCTTGTGTATTCACATTTCTTGGATCAAACATTTTGAGTGAACTAGGGGTTTTTATTAAAGACATTTGTTGTATTTATGGTTGTAACTGTACATGCTTATCAGGATGAGACTGAAAGAAGGTAGGGCAAAAATGGTTGAATCTATTTTCAGATAGTAGTTCATACTTGAGTGAAGTGTCTTGTCTGCATTATGAAGCCTGGTATGTATCCAGTACTAAATAGGTGGGTTAAATGTGGTAATTCTAGTTCAGTGTCTTACCCTGAAGAGAAAGTTGTAGGTTGGCTGTTGAAATTCATTCCTTAGATATGATCAGTTTGATTGCCCGGCTTTATTGCCTTTACAGGAATGTGATACTCAGGGCTTACTCTATACACCAATGAGTCTTCTTTGATCCTAAGACCACCACTGAAGTTGTTTAGGTTCTTTTGGACAAACATGATAAACTTCTTCAGATACTTTTTTTTTCCTTTGGCAGGAAGGTGTCTTGCTGCAGGTAACTAATGAAGAAGTGGTCAACCACAGAGTCTTCAAGAAATAAGAAATTCTGTACCATCTGAAAGTAGTTCTTGTTGGTGCCTTCATTTAAAAAGCACTCTTTAAAATAAAAGGGAAATGTTTTCTGATAAAACAAACATTTAGTTGAGGTTCTTGATATAAAACAATTACAAAATGAGTGTTGTTTGTAAAACAGTAACATCAAATTGGCTAGAGAGATAAATGTATCATGTTTTAAATTAGGTTTTGTGAGTAGACAGATTACAATTCTATTTTAAATATAAAGTTTATAAAATAAATACTTTTTGTATCCAAATACTTGGTGTAATGTTTACACATAAAATGTGTGAATCTTGTTCTATAAATATTTGGTTGTCTAAAAGATCACCATCCCCTAAATTTTTAAAAGCAGTTTCACAAAGCTATGCATATTTTAATATTAACAGGTAAATGAGAAGAGCATTGTGGACATTATTGGCTGTCCCCAATAAAATGCTGTTCATTATGCACTGTATATTCAGCGTTTGAGTACTCCTAAAGTTTCTGGCTTTACTTTTACGTTTAGCAATACTGGTGGCATTTTGAAAATCATGGATTTTAAAGGTTAACCGGCTGGAGTGGTCCAGATTAAGTGGCTTTGCAGAAGCACTGAGGTTTACAATATGTGCTAGATTGTCAAATGTCAATTAGTTTTATTGTGGTTTACACTGAGTAAATGAATATCAGTGTTGCTTTTTAAATGTGTTTATTTGGACATTTATCTGAATTAAGAAAACCAAAAAGACCAGGTTAATTTGTTTCTATG