Transcript asmbl_134662

Sequence
Transcript Sequence for observation asmbl_134662 of TGE0059564:
GTGTACTTGGTGACAGCCTTGGTGCCCTCAGACACAGCGTGCTTGGCCAGCTCCCCAGGCAGCAGCAGACGCACAGCCGTCTGGACTTCTCGGGATGTCAGGGTGGTCCGGCCCGAGTACTGGGCCAGCCGGGCAGCCTCACACGCCAGCTGCTCAAACACGTCGTTTACAAACGAGTTCATGATGCTCATGGCCTTGGCAGAGATGCCAATGTCAGGGTGCACCTGGAGAGAGGGCAGCACCACTCGGTTAATGGAAGGGGCCAGGGGAGGGGG