Transcript asmbl_129530

Sequence
Transcript Sequence for observation asmbl_129530 of TGE0059563:
TGGTCCTGCTGGTCCCGCCGGTCCCCGTGGTGAAGTGGGTCTTCCAGGCCTCTCCGGCCCCGTTGGACCTCCTGGTAATCCTGGAGCAAACGGCCTTACTGGTGCCAAGGGTGCTGCTGGCCTTCCCGGCGTTGCTGGGGCTCCCGGCCTCCCTGGACCCCGCGGTATTCCTGGCCCTGTTGGTGCTGCCGGTGCTACTGGTGCCAGAGGACTTGTTGGTGAGCCTGGTCCAGCTGGCTCCAAAGGAGAGAGCGGTAACAAGGGTGAGCCCGGCTCTGCTGGGCCCCAAGGTCCTCCTGGTCCCAGTGGTGAAGAAGGAAAGAGAGGCCCTAATGGGGAAGCTGGATCTGCCGGCCCTCCAGGACCTCCTGGGCTGAGAGGTAGTCCTGGTTCTCGTGGTCTTCCTGGAGCTGATGGCAGAGCTGGCGTCATGGGCCCTCCTGGTAGTCGTGGTGCAAGTGGCCCTGCTGGAGTCCGAGGACCTAATGGAGATGCTGGTCGCCCTGGGGAGCCTGGTCTCATGGGACCCAGAGGTCTTCCTGGTTCCCCTGGAAATATCGGCCCCGCTGGAAAAGAAGGTCCTGTCGGCCTCCCTGGCATCGACGGCAGGCCTGGCCCAATTGGCCCAGCTGGAGCAAGAGGAGAGCCTGGCAACATTGGATTCCCTGGACCCAAAGGCCCCACTGGTGATCCTGGCAAAAACGGTGATAAAGGTCATGCTGGTCTTGCTGGTGCTCGGGGTGCTCCAGGTCCTGATGGAAACAATGGTGCTCAGGGACCTCCTGGACCACAGGGTGTTCAAGGTGGAAAAGGTGAACAGGGTCCCCCTGGTCCTCCAGGCTTCCAGGGTCTGCCTGGCCCCTCAGGTCCCGCTGGTGAAGTTGGCAAACCAGGAGAAAGGGGTCTCCATGGTGAGTTTGGTCTCCCTGGTCCTGCTGGTCCAAGAGGGGAACGCGGTCCCCCAGGTGAGAGTGGTGCTGCCGGTCCTACTGGTCCTATTGGAAGCCGAGGTCCTTCTGGACCCCCAGGGCCTGATGGAAACAAGGGTGAACCTGGTGTGGTTGGTGCTGTGGGCACTGCTGGTCCATCTGGTCCTAGTGGACTCCCAGGAGAGAGGGGTGCTGCTGGCATACCTGGAGGCAAGGGAGAAAAGGGTGAACCTGGTCTCAGAGGTGAAATTGGTAACCCTGGCAGAGATGGTGCTCGTGGTGCTCCTGGTGCTGTAGGTGCCCCTGGTCCTGCTGGAGCCACAGGTGACCGGGGCGAAGCTGGGGCTGCTGGTCCTGCTGGTCCTGCTGGTCCTCGGGGAAGCCCTGGTGAACGTGGTGAGGTCGGTCCTGCTGGCCCCAATGGATTTGCTGGTCCTGCTGGTGCTGCTGGTCAACCTGGTGCTAAAGGAGAAAGAGGAGCCAAAGGGCCTAAGGGTGAAAACGGTGTTGTTGGTCCCACAGGCCCCGTTGGAGCTGCTGGCCCAGCTGGTCCAAATGGTCCCCCCGGTCCTGCTGGAAGTCGTGGTGATGGAGGCCCCCCTGGTATGACTGGTTTCCCTGGTGCTGCTGGACGGACTGGTCCCCCAGGACCCTCTGGTATTTCTGGCCCTCCTGGTCCCCCTGGTCCTGCTGGGAAAGAAGGGCTTCGTGGTCCTCGTGGTGACCAAGGTCCAGTTGGCCGAACTGGAGAAGTAGGTGCAGTTGGTCCCCCTGGCTTCGCTGGTGAGAAGGGTCCCTCTGGAGAGGCTGGTACTGCTGGACCTCCTGGCACTCCAGGTCCTCAGGGTCTTCTTGGTGCTCCTGGTATTCTGGGTCTCCCTGGCTCGAGAGGTGAACGTGGTCTACCAGGTGTTGCTGGTGCTGTGGGTGAACCTGGTCCTCTTGGCATTGCCGGCCCTCCTGGGGCCCGTGGTCCTCCTGGTGCTGTGGGTAGTCCTGGAGTCAACGGTGCTCCTGGTGAAGCTGGTCGTGATGGCAACCCTGGGAACGATGGTCCCCCAGGTCGCGATGGTCAACCCGGACACAAGGGAGAGCGCGGTTACCCTGGCAATATTGGTCCCGTTGGTGCTGCAGGTGCACCTGGTCCTCATGGCCCCGTGGGTCCTGCTGGCAAACATGGAAACCGTGGTGAAACTGGTCCTTCTGGTCCTGTTGGTCCTGCTGGTGCTGTTGGCCCAAGAGGTCCTAGTGGCCCACAAGGCATTCGTGGCGATAAGGGAGAGCCCGGTGAAAAGGGGCCCAGAGGTCTTCCTGGCTTAAAGGGACACAATGGATTGCAAGGTCTGCCTGGTATCGCTGGTCACCATGGTGATCAAGGTGCTCCTGGCTCCGTGGGTCCTGCTGGTCCTAGGGGCCCTGCTGGTCCTTCTGGCCCTGCTGGAAAAGATGGTCGCACTGGACATCCTGGTACAGTTGGACCTGCTGGCATTCGAGGCCCTCAGGGTCACCAAGGCCCTGCTGTAAGTATGATTTGGGGAAATAATAAAGAAGATCACGGACCTAAGGAATGTTTTCTTCAGACTAAACCAAGACAACTTTGACAACCCATTAAAGTTAGCCCCATTTCAATATATCCTCTAAAATATCTGGAAATTGTCTATATGCAATGGGCTTGTTAAGTCCATCCCTGCAAGTGTGCCTGGGGGCTCGTTATTTATTTATGTGAACTTGATTATTTTTTACTGATGAGAACATGCTTCCGTGTGAAGCTCAACTGAAAATCTGCTGCCATGGATGTCTCTCACTGTAACAAAATATAAAGCCTCTCCTATCTCACTTTCACCTTTGCAGGGCCCCCCTGGTCCCCCTGGCCCTCCTGGACCTCCAGGTGTAAGCGGTGGTGGTTATGACTTTGGTTACGATGGAGACTTCTACAGGGCTGACCAGCCTCGCTCAGCACCTTCTCTCAGACCCAAGGACTATGAAGTTGATGCTACTCTGAAGTCTCTCAACAACCAGATTGAGACCCTTCTTACTCCTGAAGGCTCTAGAAAGAACCCAGCTCGCACATGCCGTGACTTGAGACTCAGCCACCCAGAGTGGAGCAGTGGTTACTACTGGATTGACCCTAACCAAGGATGCACTATGGATGCTATCAAAGTATACTGTGATTTCTCTACTGGCGAAACCTGTATCCGGGCCCAACCTGAAAACATCCCAGCCAAGAACTGGTATAGGAGCTCCAAGGACAAGAAACACGTCTGGCTAGGAGAAACTATCAATGCTGGCAGCCAGTTTGAATATAATGTAGAAGGAGTGACTTCCAAGGAAATGGCTACCCAACTTGCCTTCATGCGCCTGCTGGCCAACTATGCCTCTCAGAACATCACCTACCACTGCAAG