Transcript asmbl_129421

Sequence
Transcript Sequence for observation asmbl_129421 of TGE0002555:
GTTCCAATCCTGCCTCTGCCACTTCTCAGTTGTATGCCCCAACCCAACCTGTCTGGCTCTGTCCTCCTTAACAGAAGGACGGCCCTGGCCACGGGCCACAGCCAGCAACGCTTAAGCACCAGGGCCGGCGAGTGCCCTGCCGTGGCACGGCTCCAGCGTCGCGCTCTCGAATTCATTTGCTTTCCTTAACGAGAGAAGGTTCCAGATGAGGGCTGAACCCTCTTCGCCCCGCCCACGGCCCCTGAACGCTGGGGGAGGAGTGCATGGGGAGGGGCGGCCCTCAAACGGGTCATTGCCATTAATAGAGACCTCAAACACCGCCTGCTAAAAATACCCGACTGGAGGAGCATAAAAGCGCAGCCGAGCCCAGCGCCCCGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCCGCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAAC