Transcript asmbl_129418

Sequence
Transcript Sequence for observation asmbl_129418 of TGE0056699:
GCCCCAGAGAGCAGGCGCTGGGCAGTGTGGAGGTCGTTGGAGTCACTTCCCCGTCACCAGCTCCTGTGCCTGCCAGTCGGTGCCCCTCCCGCTCCAGCCATGCTCTCCGCCCTCGCCCGGCCTGCCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCACTTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCCGGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGACCTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGGTAGTTATTCCGGCTGGAGTCCCCAGAAAGCCAGGCATGACCCGGGACGACCTGTTCAACACCAATGCCACGATTGTGGCCACCCTGACCGCTGCCTGTGCCCAGCACTGCCCGGAAGCCATGATCTGCGTCATTGCCAATCCGGTTAATTCCACCATCCCCATCACAGCAGAAGTTTTCAAGAAGCATGGAGTGTACAACCCCAACAAAATCTTCGGCGTGACGACCCTGGACATCGTCAGAGCCAACACCTTTGTTGCAGAGCTGAAGGGTTTGGATCCAGCTCGAGTCAACGTCCCTGTCATTGGTGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACCCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCACTCACTGGGCGGATCCAGGAGGCCGGCACGGAGGTGGTCAAGGCTAAAGCCGGAGCAGGCTCTGCCACCCTCTCCATGGCGTATGCCGGCGCCCGCTTTGTCTTCTCCCTTGTGGATGCAATGAATGGAAAGGAAGGTGTTGTGGAATGTTCCTTCGTTAAGTCACAGGAAACGGAATGTACCTACTTCTCCACACCGCTGCTGCTTGGGAAAAAGGGCATCGAGAAGAACCTGGGCATCGGCAAAGTCTCCTCTTTTGAGGAGAAGATGATCTCGGATGCCATCCCCGAGCTGAAGGCCTCCATCAAGAAGGGGGAAGATTTCGTGAAGACCCTGAAGTGAGCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTATGAAGGCATCATGTCACTGCAAAGCCGTTGCAGATAAACTTTGTATTTTAATTTGCTTTGGTGATGATTACTGTATTGACATCATCATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCATCAATAAAAGCCGTCCTTGATTTTATTTTTCAAGGTCCCTTCTGTAAATGCTGTGCTTTCTTCCCTGTGAGAGCCAACTTTAGAGTGTCTGCTACCTCTTCATTACCAATCAGAATTAGATGATGTTTAACTGTTAGACTGAAGCGTGACGCTTTCATCAGTAGCTTCAAGAAAGTCTAAATTGTTAATTTATGGAATTGGACACAGTATTCAGTTTACCCGTACATGCTCCTCCCGCCCCTCCTGTTGGCACCCTTGCATCGCCCAGGCCTGATTCCTCCTGGGGGTAGTTCACCCCCACGGGTTCATAGTTCAGCGGCGAATGCCAGGCAGCTGTTTTCTGGCTGAGCAAACAGCACCTTTCTCATTGAGCTTCCTCTACTGACCTCTGTCCCCCTTGGGATTTCATCTTCTGACCGAACCCTGATGTTCAGTGGCAGAGACAGCCCATAGCCAGAACTGTGGGTAGACCAGGGTTGGGGTGTGCGGTTTGGGACAGCCCAAACCCCAGCCGCTGTGTCAAGGCCTAGGACGCCATGCTGCCATCAAAAGGGGGTTCCAGGTTTCCATCAGTGGCCTAAAGAAGGGACTTCTTGTTGTACTGAGGAGTGCGGAATTAAAGAGATTTGACTCCCTTTAGTATTGGGGGCAGTCCGTTCCCCAGACACTGTGGCCTCTGAAGTGGAAACTGAAAGCTGCATACCTGGGAAAGAACTTTCTAGGAATAGGCAATGGCCTTCAGTGGAAGAGGGAGGGCTGGAGGTGTGCCCAGTACTTGGATGTTCATCTGTCCACAACAGCTTTTTGTTTTTTTAAAAAAGCTAAAATGGAAATGGATTTTATCATAAAGGATGACATCGTTTTCTTCTACAATTAATACATGTTCATTGTATAAAACCCAAAAAGCAGCTAAAAAATAAAGCGGGAAAGGAACTACTGGT