Transcript asmbl_129304

Sequence
Transcript Sequence for observation asmbl_129304 of TGE0002544:
GGACGACCTGTGGCCCAATGGCGGCGGCGCGCGGGCACGCTGGGGGCCGGCCAGACGGGCCGACTTTTCCAGAAGACCCGGATAGTTCCTCCCGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGAGCAGCTATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTGGCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCCAAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAGACGGCAATGTGCTGCTTCACGAAATGCAAATTCAACACCCAACAGCTTCCTTAATAGCAAAGGTAGCAACAGCCCAGGATGATATAACTGGTGATGGTACGACTTCTAATGTCCTAATCATTGGAGAGCTGCTGAAACAGGCGGATCTCTACATTTCTGAAGGCCTTCATCCTAGAATAATCACTGAAGGATTTGAAGCTGCAAAGGAAAAGGCCCTTCAGTTTTTGGAAGAAGTCAAAGTAAGCAGAGAGATGGACAGGGAAACACTTATAGATGTGGCCAGAACATCTCTTCGTACTAAAGTTCATGCTGAACTTGCAGATGTCTTAACAGAGGCTGTAGTGGACTCCATTTTGGCCATTAAAAAGCAAGATGAACCTATTGATCTCTTCATGATTGAGATCATGGAGATGAAACATAAATCTGAAACTGATACAAGCTTAATCAGAGGGCTTGTTTTGGACCACGGAGCACGGCATCCTGATATGAAGAAAAGGGTGGAGGATGCATACATCCTCACTTGTAACGTGTCATTAGAGTATGAGAAAACAGAAGTGAATTCTGGCTTTTTTTACAAGAGTGCAGAAGAGAGAGAAAAACTCGTGAAAGCTGAAAGAAAATTCATTGAAGATAGGGTTAAAAAAATAATAGAACTGAAAAGGAAAGTCTGTGGCGATTCAGATAAAGGATTTGTTGTTATTAATCAAAAGGGAATTGACCCCTTTTCCTTAGATGCTCTTTCAAAAGAAGGCATAGTTGCTCTGCGCAGAGCTAAAAGGAGAAATATGGAGAGGCTGACTCTTGCTTGTGGTGGGGTAGCCCTGAATTCTTTTGACGACCTAAGTCCTGACTGCTTGGGACATGCAGGACTTGTATATGAGTATACATTGGGAGAAGAGAAGTTTACCTTTATTGAGAAATGTAACAACCCTCGTTCTGTCACATTATTGATCAAAGGACCAAATAAGCACACACTCACTCAGATCAAAGATGCAGTGAGGGACGGCTTGAGGGCTGTCAAAAATGCTATTGATGATGGCTGTGTGGTTCCAGGTGCTGGTGCCGTGGAAGTGGCAATGGCAGAAGCCCTGATTAAACATAAGCCCAGTGTAAAGGGCAGGGCACAGCTTGGAGTCCAAGCATTTGCTGATGCATTGCTCATTATTCCCAAGGTTCTTGCTCAGAACTCTGGTTTTGACCTTCAGGAAACATTAGTTAAAATTCAAGCAGAACATTCAGAATCAGGTCAGCTTGTGGGTGTGGACCTGAACACAGGTGAGCCAATGGTGGCAGCAGAAGTAGGCGTATGGGATAACTATTGTGTAAAGAAACAGCTTCTTCACTCCTGCACTGTGATTGCCACCAACATTCTCTTGGTTGATGAGATCATGCGAGCTGGAATGTCTTCTCTGAAAGGTTGAATTGAAGCTTCCTCTGTATCTGAATCTTGAAGACTGCAAAGTGATCCTGAGGATTACAGCTGTGGAATTTTTGTCCAAGCTTCAAATAATTTTGAAAGAAATTTTCCCATATGAAAAAAGGAGAGAACACTGGCATCTGTTGAAATTTGGAAGTTCTGAAATTATAGTATTTTTAAAAATTGCACTGAAGTGTATACACATAAAGCAGGTCTTTTATCCAGTGAACAGGATGTTTTGCTTTAGCAGCAGTGACATAAAATTCCATGTTAGATAAGCATATGTTACTTACCTTGTTATTAAATATTTCTTGAAAAGCAAATTTTAATGGTTTAATTTTATGTGGACGTATGTTAAATTATCCAACTACCCTATTGTTAAGCATTTGGTTTTAAAATTTTTATGCTAATATAAATGCTCAAGTAATTTAAAATATTGAAAGCATCCCTGTTGGTATAAATTTCTGAGTAAATGCATTGGATCAGTTGGACTTTGAACGCCTTTGAAATGGCTTTGCTAAAATGCTCCCGCCACAAAGTTGTAGGAAATGGGAAGAGGAGTCAACTAGAGGCAAGGGAGTTGAGAGAGCTGCAACTGTAAAGGGCAAGAACAGGCAGAGGTAAAAAGATGATGGAAGGTGTGGTGACTAAGGGCCACGGTTATTGGGTGAAATTTGAGATTGTAGGCCAACTGTATTTTCAAGCTTCTGAACTTAGGCAAAATATTCATCGCAAAGTCTCTAGCGTCATATTTTTCTCACCCAAATTACGTTTCCACGAGATTATTTATATATAGTTGGTCTATCTCTGCAGTCCTTGAAGGTGAAGTTGTGTGTTACTAGGCTGTGTTTTGGGATGTCAGCAGTGGCCTGAAGTGAGTTGTGCAATAAATGTTAAGTTGAAACC