Transcript asmbl_129248

Sequence
Transcript Sequence for observation asmbl_129248 of TGE0059559:
GTGGGCACCATGCCCAGGCTCTTGGCTCTGCTCCCATTGTCTGGGCGAGGGGTGGGCTCTCAGAGGGGCTGGCAGTACTGCTCTGAGGCCTGCCTCTCCCCAGACCTTTCATGGGAACGTGGACAAGGACACACCCGTGCTGAGTGAGCTCCCAGAGCCGGTGGTGGCTCGTTTCATCCGCATCTACCCACTCACCTGGAATGGCAGCCTGTGCATGCGCCTGGAGGTGCTGGGGTGCTCTGTGGCCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTGGCCACCGATGACCTGGATTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTCATGAAGGTGGTGAACGAGGAGTGCCCCACCATCACCCGCACTTACAGCCTGGGCAAGAGCTCACGAGGCCTCAAGATCTATGCCATGGAGATCTCAGACAACCCTGGGGAGCATGAACTGGGGGAGCCCGAGTTCCGCTACACTGCTGGGATCCATGGCAACGAGGTGCTGGGCCGAGAGCTGTTGCTGCTGCTCATGCAGTACCTGTGCCGAGAGTACCGCGATGGGAACCCACGTGTGCGCAGCCTGGTGCAGGACACACGCATCCACCTGGTGCCCTCACTGAACCCTGATGGCTACGAGGTGGCAGCGCAGATGGGCTCAGAGTTTGGGAACTGGGCGCTGGGACTGTGGACTGAGGAGGGCTTTGACATCTTTGAAGATTTCCCGGATCTCAACTCTGTGCTCTGGGGAGCTGAGGAGAGGAAATGGGTCCCCTACCGGGTCCCCAACAATAACTTGCCCATCCCTGAACGCTACCTTTCGCCAGATGCCACGGTATCCACGGAGGTCCGGGCCATCATTGCCTGGATGGAGAAGAACCCCTTCGTGCTGGGAGCAAATCTGAACGGCGGCGAGCGGCTAGTATCCTACCCCTACGATATGGCCCGCACGCCTACCCAGGAGCAGCTGCTGGCCGCAGCCATGGCAGCAGCCCGGGGGGAGGATGAGGACGAGGTCTCCGAGGCCCAGGAGACTCCAGACCACGCCATCTTCCGGTGGCTTGCCATCTCCTTCGCCTCCGCACACCTCACCTTGACCGAGCCCTACCGCGGAGGCTGCCAAGCCCAGGACTACACCGGCGGCATGGGCATCGTCAACGGGGCCAAGTGGAACCCCCGGACCGGGACTATCAATGACTTCAGTTACCTGCATACCAACTGCCTGGAGCTCTCCTTCTACCTGGGCTGTGACAAGTTCCCTCATGAGAGTGAGCTGCCCCGCGAGTGGGAGAACAACAAGGAGGCGCTGCTCACCTTCATGGAGCAGGTGCACCGCGGCATTAAGGGGGTGGTGACGGACGAGCAAGGCATCCCCATTGCCAACGCCACCATCTCTGTGAGTGGCATTAATCACGGCGTGAAGACAGCCAGTGGTGGTGATTACTGGCGAATCTTGAACCCGGGTGAGTACCGCGTGACAGCCCACGCGGAGGGCTACACCCCGAGCGCCAAGACCTGCAATGTTGACTATGACATCGGGGCCACTCAGTGCAACTTCATCCTGGCTCGCTCCAACTGGAAGCGCATCCGGGAGATCATGGCCATGAACGGGAACCGGCCTATCCCACACATAGACCCATCGCGCCCTATGACCCCCCAACAGCGACGCCTGCAGCAGCGACGCCTACAACACCGCCTGCGGCTTCGGGCACAGATGCGGCTGCGGCGCCTCAACGCCACCACCACCCTAGGCCCCCACACTGTGCCTCCCACGCTGCCCCCTGCCCCTGCCACCACCCTGAGCACTACCATAGAGCCCTGGGGCCTCATACCGCCAACCACCGCTGGCTGGGAGGAGTCGGAGACTGAGACCTACACAGAGGTGGTGACAGAGTTTGGGACCGAGGTGGAGCCCGAGTTTGGGACCAAGGTGGAGCCCGAGTTTGAGACCCAGTTGGAGCCTGAGTTTGAGACCCAGCTGGAACCCGAGTTTGAGGAAGAGGAGGAGGAGGAGAA