Transcript asmbl_129246

Sequence
Transcript Sequence for observation asmbl_129246 of TGE0059558:
GTGAGTAGGGTCCTGCCAGCCCCACCTGGGTCGGACCCCTGGCCTGGGGGATGTGCCAATGGGCCCATCCCAGCCTTGGGCCCCACTCTGAGCCAGCCTCCCCCTCAGTTGAGTACATTCGGCGCCAGAAGCAACCCAGGCCACCCCCAAGCAGAAGGAGGAGGCCCGAGCGGGTCTGGCCAGAGCCCCCTGAGGAGAAGGCCCCGGCCCCAGCCCCGGAGGAGAGGATTGAGCCTCCTGTGAAGCCTCTGCTGCCCCCGCTGCCCCCTGACTATGGTGATGGTTACGTGATCCCCAACTACGATGACATGGACTATTACTTTGGGCCTCCTCCGCCCCAGAAGCCCGATGCTGAGCGCCAGACAGACGAAGAGAAGGAGGAGCTGAAGAAACCCAAAAAGGAGGACAGCAGCCCCAAGGAGGAGACCGACAAGTGGGCAGTGGAGAAGGGCAAGGACCACAAAGAGCCCCGAAAGGGCGAGGAGTTGGAGGAGGAGTGGACGCCTACGGAGAAAGTCAAGTGTCCCCCCATTGGGATGGAGTCACACCGTATTGAGGACAACCAGATCCGAGCCTCCTCCATGCTGCGCCACGGCCTGGGGGCACAGCGCGGCCGGCTCAACATGCAGACCGGTGCCACTGAGGACGACTACTATGATGGTGCGTGGTGTGCCGAGGACGATGCCAGGACCCAGTGGATAGAGGTGGACACCAGGAGGACTACCCGGTTCACAGGCGTCATCACCCAGGGCAGAGACTCCAGCATCCATGACGATTTTGTGACCACCTTCTTCGTGGGCTTCAGCAATGACAGCCAGACATGGGTGATGTACACCAACGGCTATGAGGAAATGACCTTTCATGGGAACGTGGACAAGGACACACCCGTGCTGAGTGAGCTCCCAGAGCCGGTGGTGGCTCGTTTCATCCGCATCTACCCACTCACCTGGAATGGCAGCCTGTGCATGCGCCTGGAGGTGCTGGGGTGCTCTGTGGCCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTGGCCACCGATGACCTGGATTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTCATGAAGGTGGTGAACGAGGAGTGCCCCACCATCACCCGCACTTACAGCCTGGGCAAGAGCTCACGAGGCCTCAAGATCTATGCCATGGAGATCTCAGACAACCCTGGGGAGCATGAACTGGGGGAGCCCGAGTTCCGCTACACTGCTGGGATCCATGGCAACGAGGTGCTGGGCCGAGAGCTGTTGCTGCTGCTCATGCAGTACCTGTGCCGAGAGTACCGCGATGGGAACCCACGTGTGCGCAGCCTGGTGCAGGACACACGCATCCACCTGGTGCCCTCACTGAACCCTGATGGCTACGAGGTGGCAGCGCAGATGGGCTCAGAGTTTGGGAACTGGGCGCTGGGACTGTGGACTGAGGAGGGCTTTGACATCTTTGAAGATTTCCCGGATCTCAACTCTGTGCTCTGGGGAGCTGAGGAGAGGAAATGGGTCCCCTACCGGGTCCCCAACAATAACTTGCCCATCCCTGAACGCTACCTTTCGCCAGATGCCACGGTATCCACGGAGGTCCGGGCCATCATTGCCTGGATGGAGAAGAACCCCTTCGTGCTGGGAGCAAATCTGAACGGCGGCGAGCGGCTAGTATCCTACCCCTACGATATGGCCCGCACGCCTACCCAGGAGCAGCTGCTGGCCGCAGCCATGGCAGCAGCCCGGGGGGAGGATGAGGACGAGGTCTCCGAGGCCCAGGAGACTCCAGACCACGCCATCTTCCGGTGGCTTGCCATCTCCTTCGCCTCCGCACACCTCACCTTGACCGAGCCCTACCGCGGAGGCTGCCAAGCCCAGGACTACACCGGCGGCATGGGCATCGTCAACGGGGCCAAGTGGAACCCCCGGACCGGGACTATCAATGACTTCAGTTACCTGCATACCAACTGCCTGGAGCTCTCCTTCTACCTGGGCTGTGACAAGTTCCCTCATGAGAGTGAGCTGCCCCGCGAGTGGGAGAACAACAAGGAGGCGCTGCTCACCTTCATGGAGCAGGTGCACCGCGGCATTAAGGGGGTGGTGACGGACGAGCAAGGCATCCCCATTGCCAACGCCACCATCTCTGTGAGTGGCATTAATCACGGCGTGAAGACAGCCAGTGGTGGTGATTACTGGCGAATCTTGAACCCGGGTGAGTACCGCGTGACAGCCCACGCGGAGGGCTACACCCCGAGCGCCAAGACCTGCAATGTTGACTATGACATCGGGGCCACTCAGTGCAACTTCATCCTGGCTCGCTCCAACTGGAAGCGCATCCGGGAGATCATGGCCATGAACGGGAACCGGCCTATCCCACACATAGACCCATCGCGCCCTATGACCCCCCAACAGCGACGCCTGCAGCAGCGACGCCTACAACACCGCCTGCGGCTTCGGGCACAGATGCGGCTGCGGCGCCTCAACGCCACCACCACCCTAGGCCCCCACACTGTGCCTCCCACGCTGCCCCCTGCCCCTGCCACCACCCTGAGCACTACCATAGAGCCCTGGGGCCTCATACCGCCAACCACCGCTGGCTGGGAGGAGTCGGAGACTGAGACCTACACAGAGGTGGTGACAGAGTTTGGGACCGAGGTGGAGCCCGAGTTTGGGACCAAGGTGGAGCCCGAGTTTGAGACCCAGTTGGAGCCTGAGTTTGAGACCCAGCTGGAACCCGAGTTTGAGGAAGAGGAGGAGGAGGAGAA