Transcript asmbl_129245

Sequence
Transcript Sequence for observation asmbl_129245 of TGE0059557:
CCACCCAAGGCCACCAAGAAGCCCCCGTCAGGGAAGAGGCCCCCCATTCTGGCTCCCTCAGAAACCCTGGAGTGGCCACTGCCCCCACCCCCCAGCCCTGGCCCCGAGGAGCTACCCCAGGAGGGAGGGGCGCCCCTCTCAAATAACTGGCAGAATCCAGGAGAGGAGACCCATGTGGAGGCACGGGAGCACCAGCCTGAGCCGGAGGAGGAGACCGAGCAACCCACACTGGACTACAATGACCAGATCGAGAGGGAGGACTATGAGGACTTTGAGTACATTCGGCGCCAGAAGCAACCCAGGCCACCCCCAAGCAGAAGGAGGAGGCCCGAGCGGGTCTGGCCAGAGCCCCCTGAGGAGAAGGCCCCGGCCCCAGCCCCGGAGGAGAGGATTGAGCCTCCTGTGAAGCCTCTGCTGCCCCCGCTGCCCCCTGACTATGGTGATGGTTACGTGATCCCCAACTACGATGACATGGACTATTACTTTGGGCCTCCTCCGCCCCAGAAGCCCGATGCTGAGCGCCAGACAGACGAAGAGAAGGAGGAGCTGAAGAAACCCAAAAAGGAGGACAGCAGCCCCAAGGAGGAGACCGACAAGTGGGCAGTGGAGAAGGGCAAGGACCACAAAGAGCCCCGAAAGGGCGAGGAGTTGGAGGAGGAGTGGACGCCTACGGAGAAAGTCAAGTGTCCCCCCATTGGGATGGAGTCACACCGTATTGAGGACAACCAGATCCGAGCCTCCTCCATGCTGCGCCACGGCCTGGGGGCACAGCGCGGCCGGCTCAACATGCAGACCGGTGCCACTGAGGACGACTACTATGATGGTGCGTGGTGTGCCGAGGACGATGCCAGGACCCAGTGGATAGAGGTGGACACCAGGAGGACTACCCGGTTCACAGGCGTCATCACCCAGGGCAGAGACTCCAGCATCCATGACGATTTTGTGACCACCTTCTTCGTGGGCTTCAGCAATGACAGCCAGACATGGGTGATGTACACCAACGGCTATGAGGAAATGACCTTTCATGGGAACGTGGACAAGGACACACCCGTGCTGAGTGAGCTCCCAGAGCCGGTGGTGGCTCGTTTCATCCGCATCTACCCACTCACCTGGAATGGCAGCCTGTGCATGCGCCTGGAGGTGCTGGGGTGCTCTGTGGCCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTGGCCACCGATGACCTGGATTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTCATGAAGGTGGTGAACGAGGAGTGCCCCACCATCACCCGCACTTACAGCCTGGGCAAGAGCTCACGAGGCCTCAAGATCTATGCCATGGAGATCTCAGACAACCCTGGGGAGCATGAACTGGGGGAGCCCGAGTTCCGCTACACTGCTGGGATCCATGGCAACGAGGTGCTGGGCCGAGAGCTGTTGCTGCTGCTCATGCAGTACCTGTGCCGAGAGTACCGCGATGGGAACCCACGTGTGCGCAGCCTGGTGCAGGACACACGCATCCACCTGGTGCCCTCACTGAACCCTGATGGCTACGAGGTGGCAGCGCAGATGGGCTCAGAGTTTGGGAACTGGGCGCTGGGACTGTGGACTGAGGAGGGCTTTGACATCTTTGAAGATTTCCCGGATCTCAACTCTGTGCTCTGGGGAGCTGAGGAGAGGAAATGGGTCCCCTACCGGGTCCCCAACAATAACTTGCCCATCCCTGAACGCTACCTTTCGCCAGATGCCACGGTATCCACGGAGGTCCGGGCCATCATTGCCTGGATGGAGAAGAACCCCTTCGTGCTGGGAGCAAATCTGAACGGCGGCGAGCGGCTAGTATCCTACCCCTACGATATGGCCCGCACGCCTACCCAGGAGCAGCTGCTGGCCGCAGCCATGGCAGCAGCCCGGGGGGAGGATGAGGACGAGGTCTCCGAGGCCCAGGAGACTCCAGACCACGCCATCTTCCGGTGGCTTGCCATCTCCTTCGCCTCCGCACACCTCACCTTGACCGAGCCCTACCGCGGAGGCTGCCAAGCCCAGGACTACACCGGCGGCATGGGCATCGTCAACGGGGCCAAGTGGAACCCCCGGACCGGGACTATCAATGACTTCAGTTACCTGCATACCAACTGCCTGGAGCTCTCCTTCTACCTGGGCTGTGACAAGTTCCCTCATGAGAGTGAGCTGCCCCGCGAGTGGGAGAACAACAAGGAGGCGCTGCTCACCTTCATGGAGCAGGTGCACCGCGGCATTAAGGGGGTGGTGACGGACGAGCAAGGCATCCCCATTGCCAACGCCACCATCTCTGTGAGTGGCATTAATCACGGCGTGAAGACAGCCAGTGGTGGTGATTACTGGCGAATCTTGAACCCGGGTGAGTACCGCGTGACAGCCCACGCGGAGGGCTACACCCCGAGCGCCAAGACCTGCAATGTTGACTATGACATCGGGGCCACTCAGTGCAACTTCATCCTGGCTCGCTCCAACTGGAAGCGCATCCGGGAGATCATGGCCATGAACGGGAACCGGCCTATCCCACACATAGACCCATCGCGCCCTATGACCCCCCAACAGCGACGCCTGCAGCAGCGACGCCTACAACACCGCCTGCGGCTTCGGGCACAGATGCGGCTGCGGCGCCTCAACGCCACCACCACCCTAGGCCCCCACACTGTGCCTCCCACGCTGCCCCCTGCCCCTGCCACCACCCTGAGCACTACCATAGAGCCCTGGGGCCTCATACCGCCAACCACCGCTGGCTGGGAGGAGTCGGAGACTGAGACCTACACAGAGGTGGTGACAGAGTTTGGGACCGAGGTGGAGCCCGAGTTTGGGACCAAGGTGGAGCCCGAGTTTGAGACCCAGTTGGAGCCTGAGTTTGAGACCCAGCTGGAACCCGAGTTTGAGGAAGAGGAGGAGGAGGAGAA