Transcript asmbl_129244

Sequence
Transcript Sequence for observation asmbl_129244 of TGE0059556:
CCACCCAAGGCCACCAAGAAGCCCCCGTCAGGGAAGAGGCCCCCCATTCTGGCTCCCTCAGAAACCCTGGAGTGGCCACTGCCCCCACCCCCCAGCCCTGGCCCCGAGGAGCTACCCCAGGAGGGAGGGGCGCCCCTCTCAAATAACTGGCAGAATCCAGGAGAGGAGACCCATGTGGAGGCACGGGAGCACCAGCCTGAGCCGGAGGAGGAGACCGAGCAACCCACACTGGACTACAATGACCAGATCGAGAGGGAGGACTATGAGGACTTTGAGTACATTCGGCGCCAGAAGCAACCCAGGCCACCCCCAAGCAGAAGGAGGAGGCCCGAGCGGGTCTGGCCAGAGCCCCCTGAGGAGAAGGCCCCGGCCCCAGCCCCGGAGGAGAGGATTGAGCCTCCTGTGAAGCCTCTGCTGCCCCCGCTGCCCCCTGACTATGGTGATGGTTACGTGATCCCCAACTACGATGACATGGACTATTACTTTGGGCCTCCTCCGCCCCAGAAGCCCGATGCTGAGCGCCAGACAGACGAAGAGAAGGAGGAGCTGAAGAAACCCAAAAAGGAGGACAGCAGCCCCAAGGAGGAGACCGACAAGTGGGCAGTGGAGAAGGGCAAGGACCACAAAGAGCCCCGAAAGGGCGAGGAGTTGGAGGAGGAGTGGACGCCTACGGAGAAAGTCAAGTGTCCCCCCATTGGGATGGAGTCACACCGTATTGAGGACAACCAGATCCGAGCCTCCTCCATGCTGCGCCACGGCCTGGGGGCACAGCGCGGCCGGCTCAACATGCAGACCGGTGCCACTGAGGACGACTACTATGATGGTGCGTGGTGTGCCGAGGACGATGCCAGGACCCAGTGGATAGAGGTGGACACCAGGAGGACTACCCGGTTCACAGGCGTCATCACCCAGGGCAGAGACTCCAGCATCCATGACGATTTTGTGACCACCTTCTTCGTGGGCTTCAGCAATGACAGCCAGACATGGGTGATGTACACCAACGGCTATGAGGAAATGACCTTTCATGGGAACGTGGACAAGGACACACCCGTGCTGAGTGAGCTCCCAGAGCCGGTGGTGGCTCGTTTCATCCGCATCTACCCACTCACCTGGAATGGCAGCCTGTGCATGCGCCTGGAGGTGCTGGGGTGCTCTGTGGCCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTGGCCACCGATGACCTGGATTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTCATGAAGGTGGTGAACGAGGAGTGCCCCACCATCACCCGCACTTACAGCCTGGGCAAGAGCTCACGAGGCCTCAAGATCTATGCCATGGAGATCTCAGACAACCCTGGGGAGCATGAACTGGGGGAGCCCGAGTTCCGCTACACTGCTGGGATCCATGGCAACGAGGTGCTGGGCCGAGAGCTGTTGCTGCTGCTCATGCAGTACCTGTGCCGAGAGTACCGCGATGGGAACCCACGTGTGCGCAGCCTGGTGCAGGACACACGCATCCACCTGGTGCCCTCACTGAACCCTGATGGCTACGAGGTGGCAGCGCAGATGGGCTCAGAGTTTGGGAACTGGGCGCTGGGACTGTGGACTGAGGAGGGCTTTGACATCTTTGAAGATTTCCCGGATCTCAACTCTGTGCTCTGGGGAGCTGAGGAGAGGAAATGGGTCCCCTACCGGGTCCCCAACAATAACTTGCCCATCCCTGAACGCTACCTTTCGCCAGATGCCACGGTATCCACGGAGGTCCGGGCCATCATTGCCTGGATGGAGAAGAACCCCTTCGTGCTGGGAGCAAATCTGAACGGCGGCGAGCGGCTAGTATCCTACCCCTACGATATGGCCCGCACGCCTACCCAGGAGCAGCTGCTGGCCGCAGCCATGGCAGCAGCCCGGGGGGAGGATGAGGACGAGGTCTCCGAGGCCCAGGAGACTCCAGACCACGCCATCTTCCGGTGGCTTGCCATCTCCTTCGCCTCCGCACACCTCACCTTGACCGAGCCCTACCGCGGAGGCTGCCAAGCCCAGGACTACACCGGCGGCATGGGCATCGTCAACGGGGCCAAGTGGAACCCCCGGACCGGGACTATCAATGACTTCAGTTACCTGCATACCAACTGCCTGGAGCTCTCCTTCTACCTGGGCTGTGACAAGTTCCCTCATGAGAGTGAGCTGCCCCGCGAGTGGGAGAACAACAAGGAGGCGCTGCTCACCTTCATGGAGCAGGTGCACCGCGGCATTAAGGGGGTGGTGACGGACGAGCAAGGCATCCCCATTGCCAACGCCACCATCTCTGTGAGTGGCATTAATCACGGCGTGAAGACAGGTACCTAGTGTGCACACCTTTACCCCATCTTTCTGAGGGAGGACCCGCCAGAGAGGGTGGGGGCTTGAGGAACTCAGCGAGCAGGTAGAGTCTGGGGAGCCTGGGGGCGAAATTCAGAGAGGGAGGGCGGTGCTGGGGGCGGG