Transcript asmbl_128547

Sequence
Transcript Sequence for observation asmbl_128547 of TGE0009126:
CTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAGAAAAAAAATTACTTATTTTCTTGCCCCATACATACCTTGAGGCGAGCAAAAAAATTAAATTTTAACCATGAGGGAAATCGTGCACATCCAGGCTGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGATCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGGGGACAGCGACCTGCAGCTGGACCGCATCTCTGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCCATCCTGGTGGATCTAGAACCTGGGACCATGGACTCTGTTCGCTCAGGTCCTTTTGGCCAGATCTTTAGACCAGACAACTTTGTATTTGGTCAGTCTGGGGCAGGTAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAGCTGGTTGATTCTGTCCTGGATGTGGTACGGAAGGAGGCAGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCACTGGGCGGGGGCACAGGCTCTGGAATGGGCACTCTCCTTATCAGCAAGATCCGAGAAGAATACCCTGATCGCATCATGAATACCTTCAGTGTGGTGCCTTCACCCAAAGTGTCTGACACCGTGGTCGAGCCCTACAATGCCACCCTCTCCGTCCATCAGTTGGTAGAGAATACTGATGAGACCTATTGCATTGACAACGAGGCCCTCTATGATATCTGCTTCCGCACTCTGAAGCTGACCACACCAACCTACGGGGATCTGAACCACCTTGTCTCAGCCACCATGAGTGGTGTCACCACCTGCCTCCGTTTCCCTGGCCAGCTCAATGCTGACCTCCGCAAGTTGGCAGTCAACATGGTCCCCTTCCCACGTCTCCATTTCTTTATGCCTGGCTTTGCCCCTCTCACCAGCCGTGGAAGCCAGCAGTATCGAGCTCTCACAGTGCCGGAACTCACCCAGCAGGTCTTCGATGCCAAGAACATGATGGCTGCCTGTGACCCCCGCCACGGCCGATACCTCACCGTGGCTGCTGTCTTCCGTGGTCGGATGTCCATGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACAGCAGCTACTTTGTGGAATGGATCCCCAACAATGTCAAGACAGCCGTCTGTGACATCCCACCTCGTGGCCTCAAGATGGCAGTCACCTTCATTGGCAATAGCACAGCCATCCAGGAGCTCTTCAAGCGCATCTCGGAGCAGTTCACTGCCATGTTCCGCCGGAAGGCCTTCCTCCACTGGTACACAGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCTGAGAGCAACATGAACGACCTCGTCTCTGAGTATCAGCAGTACCAGGATGCCACCGCAGAAGAGGAGGAGGATTTCGGTGAGGAGGCCGAAGAGGAGGCCTAAGGCAGAGCCCCCATCACCTCAGGCTTCTCAGTTCCCTTAGCCGTCTTACTCAACTGCCCCTTTCCTCTCCCTCAGAATTTGTGTTTGCTGCCTCTATCTTGTTTTTTGTTTTTTCTTCTGGGGGGGGTCTAGAACAGTGCCTGGCACATAGTAGGCGCTCAATAAATACTTGTTTGTTGAATGTCTCCTCTCTCTTTCCACTCTGGGAAACCTAGGTTTCTGCCATTCTGGGTGACCCTGTATTTCTTTCTGGTGCCCATTCCATTTGTCCAGTTAATACTTCCTCTTAAAAATCTCCAAGAAGCTGGGTCTCCAGATCCCATTTAGAACCAACCAGGTGCTGAAAACACATGTAGATAATGGCCATCATCCTAAGCCCAAAGTAGAAAATGGTAGAAGGTAGTGGGTAGAAGTCACTATATAAGGAAGGGGATGGGATTTTCCATTCTAAAAGTTTTGGAGAGGGAAATCCAGGCTATTAAAGTCACTAAATTTCTAAGTATGTCCATTTCCCATCTCAGCTTCAAGGGAGGTGTCAGCAGTATTATCTCCACTTTCAATCTCCCTCCAAGCTCTACTCTGGAGGAGTCTGTCCCACTCTGTCAAGTGGAATCCTTCCCTTTCCAACTCTACCTCCCTCACTCAGCTCCTTTCCCCTGATCAGAGAAAGGGATCAAGGGGGTTGGGAGGGGGGAAAGAGACCAGCCTTGGTCCCTAAGCCTCCAGAAACGTCTTCTTAATCCCCACCTTTTCTTACTCCCAAAAAAGAATGAACACCCCTGACTCTGGAGTGGTGTATACTGCCACATCAGTGTTTGAGTCAGTCCCCAGAGGAGAGGGGAACCCTCCTCCATCTTTTTTGCAACATCTCATTTCTTCCTTTTGCTGTTGCTTCCCCCCTCACACACTTGGTTTTGTTCTATCCTACATTTGAGATTTCTATTTTATGTTGAACTTGCTGCTTTTTTTCATATTGAAAAGATGACATCGCCCCAAGAGCCAAAAATAAATGGGAATTGAAAA