Transcript asmbl_127081

Sequence
Transcript Sequence for observation asmbl_127081 of TGE0059555:
TCGGAAAGCAAGCCTACGTTGCTCACTATTACGTATAATCCTTTTCTTTTCAAGATGCCTGAGGAAGTGCACCATGGAGAGGAGGAGGTGGAGACTTTTGCCTTTCAGGCAGAAATTGCCCAACTCATGTCCCTCATCATCAATACCTTCTATTCCAACAAGGAGATTTTCCTTCGGGAGTTGATCTCTAATGCTTCTGATGCCTTGGACAAGATTCGCTATGAGAGCCTGACAGACCCTTCGAAGTTGGACAGTGGTAAAGAGCTGAAAATTGACATCATCCCCAACCCTCAGGAACGTACCCTGACTTTGGTAGACACAGGCATTGGCATGACCAAAGCTGATCTCATAAATAATTTGGGAACCATTGCCAAGTCTGGTACTAAAGCATTCATGGAGGCTCTTCAGGCTGGTGCAGACATCTCCATGATTGGGCAGTTTGGTGTTGGCTTTTATTCTGCCTACTTGGTGGCAGAGAAAGTGGTTGTGATCACAAAGCACAACGATGATGAACAGTATGCTTGGGAGTCTTCTGCTGGAGGTTCCTTCACTGTGCGTGCTGACCATGGTGAGCCCATTGGCAGGGGTACCAAAGTGATCCTCCATCTTAAAGAAGATCAGACAGAGTACCTAGAAGAGAGGCGGGTCAAAGAAGTAGTGAAGAAGCATTCTCAGTTCATAGGCTATCCCATCACCCTTTATTTGGAGAAGGAACGAGAGAAGGAAATTAGTGATGATGAGGCAGAGGAAGAGAAAGGTGAGAAAGAAGAGGAAGATAAAGATGATGAAGAAAAACCCAAGATCGAAGATGTGGGTTCAGATGAGGAGGATGACAGCGGTAAGGATAAGAAGAAGAAAACTAAGAAGATCAAAGAGAAATACATTGATCAGGAAGAACTAAACAAGACCAAGCCTATTTGGACCAGAAACCCTGATGACATCACCCAAGAGGAGTATGGAGAATTCTACAAGAGCCTCACTAATGACTGGGAAGACCACTTGGCAGTCAAGCACTTTTCTGTAGAAGGTCAGTTGGAATTCAGGGCATTGCTATTTATTCCTCGTCGGGCTCCCTTTGACCTTTTTGAGAACAAGAAGAAAAAGAACAACATCAAACTCTATGTCCGCCGTGTGTTCATCATGGACAGCTGTGATGAGTTGATACCAGAGTATCTCAATTTTATCCGTGGTGTGGTTGACTCTGAGGATCTGCCCCTGAACATCTCCCGAGAAATGCTCCAGCAGAGCAAAATCTTGAAAGTCATTCGCAAAAACATTGTTAAGAAGTGCCTTGAGCTCTTCTCTGAGCTGGCAGAAGACAAGGAGAATTACAAGAAATTCTATGAGGCATTCTCTAAAAATCTCAAGCTTGGAATCCACGAAGACTCCACTAACCGCCGCCGCCTGTCTGAGCTGCTGCGCTATCATACCTCCCAGTCTGGAGATGAGATGACATCTCTGTCAGAGTATGTTTCTCGCATGAAGGAGACACAGAAGTCCATCTATTACATCACTGGTGAGAGCAAAGAGCAGGTGGCCAACTCAGCTTTTGTGGAGCGAGTGCGGAAACGGGGCTTCGAGGTGGTATATATGACCGAGCCCATTGACGAGTACTGTGTGCAGCAGCTCAAGGAATTTGATGGGAAGAGCCTGGTCTCAGTTACCAAGGAGGGTCTGGAGCTGCCTGAGGATGAGGAGGAGAAGAAGAAGATGGAAGAGAGCAAGGCAAAGTTTGAGAACCTCTGCAAGCTCATGAAAGAAATCTTAGATAAGAAGGTTGAGAAGGTGACAATCTCCAATAGACTTGTGTCTTCACCTTGCTGCATTGTGACCAGCACCTACGGCTGGACAGCCAATATGGAGCGGATCATGAAAGCCCAGGCACTTCGGGACAACTCCACCATGGGCTATATGATGGCCAAAAAGCACCTGGAGATCAACCCTGACCACCCCATTGTGGAGACGCTGCGGCAGAAGGCTGAGGCCGACAAGAATGATAAGGCAGTTAAGGACCTGGTGGTGCTGCTGTTTGAAACCGCCCTGCTATCTTCTGGCTTTTCCCTTGAGGATCCCCAGACCCACTCCAACCGCATCTATCGCATGATCAAGCTAGGTCTAGGTATTGATGAAGATGAAGTGGCAGCAGAGGAACCCAATGCTGCAGTTCCTGATGAGATCCCCCCTCTCGAGGGCGATGAGGATGCGTCTCGCATGGAAGAAGTCGATTAGGTTAGGAGTTCATAGTTGGAAAACTTGTGCCCTTGTATAGTGTCCCCATGGGCTCCCACTGCAGCCTCGAGTGCCCCTGTCCCACCTGGCTCCCCCTGCTGGTGTCTAGTGTTTTTTTCCCTCTCCTGTCCTTGTGTTGAAGGCAGTAAACTAAGGGTGTCAAGCCCCATTCCCTCTCTACTCTTGACAGCAGGATTGGATGTTGTGTATTGTGGTTTATTTTATTTTCTTCATTTTGTTCTGAAATTAAAGTATGCAAAATAAAGAATATGCCGTTTTTATACAGTTCTGCTTTCCCTTG