Transcript asmbl_126910

Sequence
Transcript Sequence for observation asmbl_126910 of TGE0003604:
CAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGTTGGCACCGTTCTGATCCCACCCAGCCCTCAGTGCCCCCGTGCTTGCCCCTCCCCTGCAGGCTCCCGCTGAGCCGGAGGCGGGCACGTCGGTACTGATGTGCTAGGGTAGTTCAGACCCCCTGCTCCGGGCAGGCGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACATGAGGGGAGGCGTGGGTAGGCCTCGGCCGAGCCCGCCGGCCAGCCTGAGAAGCCAGGCTGGCTGCTGGTGAATGTGAACGCTCCGGGTAAGGCTCGGTGGCTGCTGCGGTCCCAGACCCTTCACCGGCCCTTGGGACCCAGGGCTAGGCGTAACCTGTTGGTGCTGTCCCCCAAAACGCAGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAGTT