Transcript asmbl_126909

Sequence
Transcript Sequence for observation asmbl_126909 of TGE0003604:
CAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGTTGGCACCGTTCTGATCCCACCCAGCCCTCAGTGCCCCCGTGCTTGCCCCTCCCCTGCAGGCTCCCGCTGAGCCGGAGGCGGGCACGTCGGTACTGATGTGCTAGGGTAGTTCAGACCCCCTGCTCCGGGCAGGCGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACATGAGGGGAGGCGTGGGTAGGCCTCGGCCGAGCCCGCCGGCCAGCCTGAGAAGCCAGGCTGGCTGCTGGTGAATGTGAACGCTCCGGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAGTT