Transcript asmbl_122177

Sequence
Transcript Sequence for observation asmbl_122177 of TGE0059553:
TATCCAGCTCTTTTATTGAGATCAGTGGTGGCTCTGAAAAGAGCCTTTTGGGTTTTAGAAGTAGGCGTTCGCCTATTTCTTCTTGGGCGCCGCCTTCTTAGGCTTGACAACCTTGGGCTTAGCGGCCTTGGGCTTCACAGCCTTAGCAGCACTTTTGGCAGCTTTCTTGGGCTTCGCAACCTTGGCCTTCTTTGGGCTCTTAGCCACTTTCTTGGTTACAGTGGCCGCGGCCGGCTTCTTCGCTTTCTTCGGTGTTTTCTTAGCGCTCTTCTTCGGAGTTGCGCCGCCAGCCGCCTTCTTGGGCTTCTTGGCTGCCCCAACTGGCTTCTTAGGTTTGGTTCCGCCCGCCTTTTTAACCTTGGGCTTGGCTTCCCCGGAGGCTGCCTTCTTGTTGAGTTTAAAGGAGCCAGAAGCACCGGTGCCTTTCGTTTGCACCAGAGTGCCCTTGCTCACCAGGCTCTTGAGACCAAGTTTGATACGGCTGTTGTTTTTCTCCACATCATAGCCGGCGGCAGCCAACGCTTTTTTCAGAGCAGCCAGAGAAACTCCGCTACGCTCTTTAGAGGCGGCCACAGCCTTGGTGATGAGCTCTGACACCGGGGGACCAGACGCCTTACGAGGCGTACCCCCAGCCTTTTTGGCCGCCTTCTTCTTTACAGGGGCCTTCTCCGCAGGAGGCGCGGCAGCGGGAGCGGCAGGAGCAGTCTCGGACATGTTGAGAATCAAAAACTCGGGTACAAGTGGCAAAGCGCCGAT