Transcript asmbl_121566

Sequence
Transcript Sequence for observation asmbl_121566 of TGE0059552:
TTTTCTACACATGCTTTTTTATTAGTATAGATACCTTCACAGACAATACTGTAATTTTTAGAGGAGTTCCACATCATTACATCAACAGTGTGAATTTCTAACAGAGGCAAAACTGAGCACCATAGTTTACAAGTAGAAAGACCATGCTTGAGGACAACAGAAGTTCACTAAGGATGCACGATTGATCTGAGAAGTTTTTAAGCCTCGTCCTCGCCCTCCTCCTCCTCGAACTCCCCTTGTTCGTCGGCCGTGGCGTCCTGGTACTGCTGGTACTCGGACACCAGGTCGTTCATGTTGCTCTCGGCCTCGGTGAACTCCATCTCGTCCATGCCCTCGCCCGTGTACCAGTGCAGGAAGGCCTTGCGCCGGAACATGGCCGTGAACTGCTCGGAGATGCGCTTGAACAGCTCCTGGATGGCCGTGCTGTTGCCGATGAAGGTGGCCGACATCTTCAGGCCGCGGGGCGGGATGTCGCACACGGCCGTCTTCACGTTGTTGGGGATCCACTCCACGAAGTAGCTGCTGTTCTTGTTCTGCACGTTGAGCATCTGCTCGTCCACCTCCTTCATGGACATGCGGCCCCGGAAGATGGCAGCCACCGTCAGGTAGCGGCCGTGGCGCGGGTCGCAGGCGGCCATCATGTTCTTGGAGTCGAACATCTGCTGGGTGAGCTCGGGCACCGTGAGCGCCCGGTACTGCTGGCTGCCCCGGCTGGTCAGGGGCGCGAAGCCGGGCATGAAGAAGTGCAGGCGAGGGAAGGGCACCATGTTCACCGCCAGCTTGCGCAGGTCTGCGTTCAGCTGGCCCGGGAAGCGCAGGCAGGTGGTGACCCCGCTCATGGTGGCCGACACCAGGTGGTTGAGGTCCCCGTAGGTGGGGGTGGTCAGCTTCAGGGTGCGGAAGCAGATGTCATACAGGGCCTCGTTATCAATGGAGTAGGTTTCATCTGTGTTTTCCACCAGCTGGTGGAC