Transcript asmbl_121275

Sequence
Transcript Sequence for observation asmbl_121275 of TGE0059551:
AAGCGATCCTCCTGCCTCGGCCTCGCAGTGTTGGGATTACACCTGTGAGCCACAGTGTCTGGCCCCATTTACACTCTTAGTAGGTGGTTTTTAAATAATTAACACAGATTTGTAGATTTGGGAAATACGGGGGCTGTTGGATGTCATTTACCTTTAGGCTGAAATTACTGTCTTTCAGAGTTGTGGCTTATCCTCATTTCTTTTTTATTTTTAATTGATTGTCTACAGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGCTTGGATAAAATGTTGGTGGATGATATTGGTGTAAGTACACATAACTGTTGTGTTAGTTTCCTTAAAGTAAAACTATCTTCAGTGTTTTGCTATGTTCTTTCTTTGACTTTATCAGAATCCACGTACTGGAAGGTGATATTAAAGGTGAACGTGTATTATAATGGGGCTGTGTTGATTTCTATAAGTGGTTCATATTTTTTCCTGCGAATTTCTTAGGATGTAACCATTACTAACGATGGTGCAACCATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGATCTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTCCTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACAGATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATCATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAATACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCCCATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTGGGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGCCTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTGGACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTTGTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCCAAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTTGAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAGCTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCAAATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAGAGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCCATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAGCTTGCGATTGCAGAGTTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGGACTCCACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAGGTTAACCCAGAACGTAAAAATCTAAAATGGATTGGTCTTGATTTGAGCAATGGTAAACCTCGAGACAACAAACAAGCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCTGCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCAGAAAGTAAAGATGATAAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAATGATTGATCTGATGTTCCTTTTATTTATAACAATGTTAAATGCAATTGTCTTGTACCTTGAGTTGAGTATTACACATTAAAGTAAAGTACAAGCTGTAAACTTGGGTTTTTGTGATGTAGGAAATGGTTTCCATCTGTACTTTGGTCCTCTGATTTCACATATTGCAACCTAGTACTTTATTAGTTTAAAAAGAAATTGAGGTTGTTCAAAGTTTAAGCAATTCATTCTCTCTGAACACACATTGCTATTCCCATCCCACCCCCAATGCACAGGGCTGCAACACCACGACTTCTGCCCATTCTCTCCAGTGTGTGTAACAGGGTCACAAGAATTCGACAGCCAGATGCTCCAAGAGGGTGGCCCAAGGCTATAGCCCCTCCTTCAATATTGACCTAACGGGGGAGAAAAGATTTAGATTGTTTATTCTTCTGTGGACACAGTTTAAAATCTTAAACTTGTCTTTTTCCTCTTAATGTATCAGCATGCTACCCTTTCAAACTCAAATTTTCATTTTAACTGCTTAGGAATAAATTTACACCTTTGTGAAAAT