Transcript asmbl_121274

Sequence
Transcript Sequence for observation asmbl_121274 of TGE0056695:
CGGAGCCTCACTTCCGTCACAGTCCTGTTTCTCTCCCTGTTGTCCCTGCCTCTTTTTCCTTCCCGCCGTGCCCCGCGGCCGGGCCGGGGCAGCCGGGAAGCGGGTGGGGTGGTGTGTTACCCAGTAGCTCCTGGGACATCGCTCGGGTACGCTCCACGCCGTCGCAGCCACTGCTGTGGTCGCCGGTCGGCCGAGGGGCCGCGATACTGGTTGCCCGCGGTGTAAGCAGAATTCGACGTGTATCGCTGCCGTCAAGATGGAGGGGCCTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAACGATCCGCTCCCAAAACGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGCTTGGATAAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCAACCATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGATCTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTCCTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACAGATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATCATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAATACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCCCATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTGGGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGCCTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTGGACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTTGTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCCAAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTTGAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAGCTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCAAATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAGAGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCCATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAGCTTGCGATTGCAGAGTTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGGACTCCACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAGGTTAACCCAGAACGTAAAAATCTAAAATGGATTGGTCTTGATTTGAGCAATGGTAAACCTCGAGACAACAAACAAGCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCTGCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCAGAAAGTAAAGATGATAAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAATGATTGATCTGATGTTCCTTTTATTTATAACAATGTTAAATGCAATTGTCTTGTACCTTGAGTTGAGTATTACACATTAAAGTAAAGTACAAGCTGTAAACTTGGGTTTTTGTGATGTAGGAAATGGTTTCCATCTGTACTTTGGTCCTCTGATTTCACATATTGCAACCTAGTACTTTATTAGTTTAAAAAGAAATTGAGGTTGTTCAAAGTTTAAGCAATTCATTCTCTCTGAACACACATTGCTATTCCCATCCCACCCCCAATGCACAGGGCTGCAACACCACGACTTCTGCCCATTCTCTCCAGTGTGTGTAACAGGGTCACAAGAATTCGACAGCCAGATGCTCCAAGAGGGTGGCCCAAGGCTATAGCCCCTCCTTCAATATTGACCTAACGGGGGAGAAAAGATTTAGATTGTTTATTCTTCTGTGGACACAGTTTAAAATCTTAAACTTGTCTTTTTCCTCTTAATGTATCAGCATGCTACCCTTTCAAACTCAAATTTTCATTTTAACTGCTTAGGAATAAATTTACACCTTTGTGAAAAT