Transcript asmbl_121273

Sequence
Transcript Sequence for observation asmbl_121273 of TGE0056694:
CGGAGCCTCACTTCCGTCACAGTCCTGTTTCTCTCCCTGTTGTCCCTGCCTCTTTTTCCTTCCCGCCGTGCCCCGCGGCCGGGCCGGGGCAGCCGGGAAGCGGGTGGGGTGGTGTGTTACCCAGTAGCTCCTGGGACATCGCTCGGGTACGCTCCACGCCGTCGCAGCCACTGCTGTGGTCGCCGGTCGGCCGAGGGGCCGCGATACTGGTTGCCCGCGGTGTAAGCAGAATTCGACGTGTATCGCTGCCGTCAAGATGGAGGGGCCTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAACGATCCGCTCCCAAAACGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGCTTGGATAAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCAACCATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGATCTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTCCTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACAGATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATCATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAATACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCCCATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTGGGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGCCTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTGGACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTTGTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCCAAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTTGAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAGCTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCAAATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAGAGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCCATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAGCTTGCGATTGCAGAGTTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGGACTCCACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAGGTTAACCCAGAACGTAAAAATCTAAAATGGTAAGCATGGTTTCCCGCTCTTTGTTAACCTCTGCAGAACAGGTTGCATTAAAAAGGATAGTAGTCAATTACATGTCAGCAAACATAAGTAACAGACTTGTCAAATACTTAACATGAAAAACTTCACAGCAAGCATTTGTTGTTCAGTCACTGTAATTCAAGGGATAATGACTAATTATTAGCACTGGTGTGTCTTCGTTAACTGTGATTGCTAATCTCTCCCTGCTTCTTTTGGTAGAAAGACTACCTACAAGATCTCTAGTCTGATTTAAAAATCAACCTTAATACTTGAATGAAATGCTGGAGTTAATAGGCCACCTAATGAAATTGTAAGCGGCCGTTAAATAATTCTTTCTTAATTGCAGGATTGGTCTTGATTTGAGCAATGGTAAACCTCGAGACAACAAACAAGCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCTGCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCAGAAAGTAAAGATGATAAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAATGATTGATCTGATGTTCCTTTTATTTATAACAATGTTAAATGCAATTGTCTTGTACCTTGAGTTGAGTATTACACATTAAAGTAAAGTACAAGCTGTAAACTTGGGTTTTTGTGATGTAGGAAATGGTTTCCATCTGTACTTTGGTCCTCTGATTTCACATATTGCAACCTAGTACTTTATTAGTTTAAAAAGAAATTGAGGTTGTTCAAAGTTTAAGCAATTCATTCTCTCTGAACACACATTGCTATTCCCATCCCACCCCCAATGCACAGGGCTGCAACACCACGACTTCTGCCCATTCTCTCCAGTGTGTGTAACAGGGTCACAAGAATTCGACAGCCAGATGCTCCAAGAGGGTGGCCCAAGGCTATAGCCCCTCCTTCAATATTGACCTAACGGGGGAGAAAAGATTTAGATTGTTTATTCTTCTGTGGACACAGTTTAAAATCTTAAACTTGTCTTTTTCCTCTTAATGTATCAGCATGCTACCCTTTCAAACTCAAATTTTCATTTTAACTGCTTAGGAATAAATTTACACCTTTGTGAAAAT