Transcript asmbl_121084

Sequence
Transcript Sequence for observation asmbl_121084 of TGE0059547:
GCCGGCCCTCAGAGTCCTCTGACGGCCCCAGTCAGGGAATTTCAATTTGAAACCTAGCGGAGGGAGGAGGCAGGCGCGGCTGCCGGCGGCTGGGACTGAAGAGGGACGGGTCCCGCGGCGAGCGAGCTCCTGAGGTACGGCGTCGGGCATAAGCTGTGGCCATGACTACTGAAGTAGGCTCTGTGTCTGAAGTGAAGAAGGACTCTAGCCAGTTAGGAACAGATGCAACCAAGGAAAAACCTAAAGAAGTAGCAGAAAATCAGCAGAATCAGTCTTCCGATCCAGAGGAGGAAAAAGGTTCCCAGCCACCTCCTGCAGCTGAAAGCCAAAGTAGTCTACGCCGCCAGAAGAGAGAGAAGGAAACATCGGAGAGCAGGGGTATTTCTCGGTTCATACCGCCATGGCTTAAGAAGCAAAAGTCATATACCTTAGTAGTGGCCAAAGATGGAGGAGATAAAAAAGAGCCTACCCAAGCTGTTGTTGAAGAACAGGTCTTAGATAAAGAGGAACCCCTTCCAGAAGAACAGAGACAGGCTAAGGGTGATGCTGAAGAAATGGCTCAGAAGAAACAAGAGATTAAAGTTGAAGTCAAGGAAGAAAAACCCTCAGTGAGCAAGGAAGAAAAACCCTCAGTGAGCAAAGTGGAGATGCAGCCTACTGAATTAGTAAGTAAGGAGAGAGAAGAGAAGGTAAAAGAAACACAGGAAGACAAATTAGAAGGAGGAGCAGCAAAAAGGGAGACCAAGGAAGTGCAGACCAATGAGCTGAAAGCAGAGAAGGCATCTCAAAAAGTCACCAAGAAGACCAAAACTGTCCAGTGTAAAGTGACCCTCTTAGATGGCACCGAATACAGCTGTGACCTGGAGAAACATGCCAAGGGACAAGTGTTATTTGACAAAGTGTGTGAACACCTCAATCTCTTGGAGAAAGACTACTTTGGACTTTTGTTTCAGGAAAGCCCTGAGCAGAAAAACTGGTTAGATCCTGCTAAAGAAATAAAGAGACAACTGAGAAACCTTCCATGGCTATTCACTTTTAATGTGAAGTTTTATCCTCCTGATCCTTCTCAATTGACTGAAGATATCACCAGATACTTCTTGTGCCTTCAGCTCCGGCAGGACATTGCCTCTGGCCGCCTGCCCTGCTCTTTTGTGACTCATGCTCTCCTGGGATCCTACACCCTGCAGGCTGAACTTGGTGACTATGACCCAGAAGAACATGGCAGCATCGACCTCAGTGAATTCCAGTTTGCCCCTACTCAGACTAAGGAGCTGGAAGAGAAGGTGGCAGAGCTGCACAAAACCCACAGGGGCTTATCGCCAGCACAAGCTGATTCCCAGTTCTTAGAAAATGCAAAGAGGCTTTCCATGTATGGTGTTGACCTACATCATGCCAAGGACTCAGAAGGTGTGGACATCAAGCTGGGCGTGTGTGCTAATGGACTTCTCATTTACAAAGACAGACTGCGAATCAATCGTTTTGCTTGGCCGAAAATCTTAAAAATTTCCTATAAACGCAGTAACTTCTACATTAAAGTCAGACCGGCAGAGCTGGAACAGTTTGAGAGTACCATTGGATTCAAACTGCCAAACCACCGGGCAGCGAAAAGACTATGGAAAGTGTGCGTGGAGCATCATACTTTCTACAGGCTTGTTTCTCCAGAGCAGCCACCAAAAGCCAAGTTCCTGACCTTGGGGTCCAAATTTCGCTATAGTGGCCGCACCCAAGCACAGACCCGCCAGGCCAGCACCCTCATAGATAGGCCAGCACCACACTTTGAGCGCACTTCTAGTAAACGGGTCTCCAGGAGTCTAGATGGAGCTCCGATTGGTGTCATGGACCAAAGTCTTATGAAGGATTTTCCTGGCGCTGCTGGGGAGATTTCAGCCTATGGACCTGGACTTGTCAGCATTGCCGTGGTACAAGATGGGGACGGCAGGAGGGAAGTGAGAAGCCCAACTAAAGCCCCACATTTGCAGCTCATTGAAGGAAAGAAAAATTCCTTGAGAGTAGAAGGGGATAATATTTATGTCAGACATAGCAATTTAATGTTGGAGGAACTGGATAAGGCCCAGGAGGACATACTGAAACATCAGGCTAGCATTAGTGAACTCAAGCGCAATTTTATGGAATCCACACCTGAGCCGCGCCCTAATGAATGGGAAAAACGACGTATCACACCTCTGTCCCTACAGACACAAGGGAGTTCACATGAGACTCTGAATATAGTGGAGGAGAAGAAGCGGGCAGAGGTTGGGAAAGACGAAAGAGTAATCACAGAAGAAATGAATGGTAAAGAGATATCACCTGGGAGTGGTCCTGGGGAGATTCGTAAGGTGGAGCCTGTGACACAAAAAGACTCCACCTCCCTGTCTTCTGAGAGCAGCAGCAGCAGCAGTGAGAGTGAGGAGGAAGACGTGGGAGAGTACCGTCCCCACCACCGAGTGACCGAGGGCACCATCAGGGAGGAACAGGAGTATGAAGAAGAGGTGGAGGAAGAACCCCGCCCGGCAGCCAAGGTAGTAGAGAGGGAGGAAGCAGTGCCCGAAGCCAGCCCAGTCACACAAGCAGGTGCCAGTGTAATCACAGTAGAAACAGTGATCCAGGAAAATGTAGGTGCCCAAAAGATACCCGGAGAGAAGAGTGTACACGAAGGCGCTCTTAAGCAAGACATGGGAGAAGAAGCAGAGGAAGAGCCACAGAAAGTTAACGGAGAGGTGTCCCATGTTGACATTGATGTTTTGCCACAAATTATTTGTTGTTCAGAGCCACCAGTGGTAAAAACAGAGATGGTAACAATTTCTGATGCCTCACAAAGGACAGAAATCTCCACCAAGGAAGTCCCCATTGTCCAAACTGAGACCAAAACCATCACATATGAGTCTCCACAGATTGATGGCGGGGCTGGTGGTGATTCGGGCACGTTACTGACCGCACAAACCATCACATCTGAGTCCGTGTCAACAACGACAACCACACACATCACCAAGACTGTAAAAGGTGGAATTTCTGAAACAAGAATTGAGAAACGCATTGTGATCACAGGAGATGGAGATATTGATCATGACCAGGCACTGGCTCAGGCGATCAGGGAAGCCAGAGAGCAGCACCCTGACATGTCGGTCACAAGAGTGGTGGTACACAAAGAAACAGAGTTGGCTGAGGAAGGGGAAGATTAAGTAAGAAAGTCATTTTTTAAACAACACTCAACTTTGTGAACCCCTGAAGATTTTTTGACCGTTCCAAGTCTTAATGCCACACCACTATTCCAGCGAATTTATGCTACAACTGGTAACAATGACCAGAAGCCTGAAGAATTAAAATGCCAACACCAAACCTTTCCTTACCAGCTCTGGTCTATATTGCTCCCATGCATTTAATATATTATTTTGTTTTATAACCACTTCTAAATATTCTCAGTTCTTTCTTTTTGTTGTTGTTAATTAAGGGGTTTTGGTTTTGTTTTCTGTTTACTTTGTGTGCAACTACCTGCTTTTAATGACTCACTTTGATCAAATGACAGTGAACAAAGCCAGCCCAAGCTGGTAAGGTGCTGTTCACTTGAACAGGTGCTGTTGCGCAGAAAGGAAACTCTGTGACTAATTTAGATAGTGGCTTTCCTTCTTCTGGATTCTTTTCATTGAATTCTCACAGTAAATATTTACGGAGTTTTCAAATTGCAGCAAATATACTGTATGAGAAAATATTAATACAGATTAAAAGCCTTTCTTACATCTTGAAAATTTTCTAATATTTGAGAATTTCACAGGGATGTTTTTTATATTGGACCCTTTTGACTTTCCAGTCCTGTGACTTTCTACTTTTAGTAGAGAGTCAGAATCTCTGGACTGGAGAATAATGAAGAAGTTCACTGACTGTGCACTGTGCTTAGAGACCCTGCCGCACCACAGTGCCAATGCTTGTCAGACACATGCCCTTCGGCAGCATTCCAGAACAGGAGGGAAGAGAAAGAGAAAACTTTCTTCCCTTCTACTAAAAGATTCAGGCAGCTTAAAACCTTAGTGCTTTCTTTCTTAACATACCCACATTTCAATTCTTTCCATTATTTGAACACTTGGGTAGAACTCTTGCTTTGTATTAAACCTCTTTGTCTACACATGTAAAACTTACCTTTTGTTATTGAGCAGGCCTATCTCTTTCAGATAGTTTTATGATTCACACAGGTTTGAGGATGCTGGGGAGAGGGGGAGGGGGCTGTGGTGGTGTTCTGTTGGTTACAAGAAAGTTATACCATTTAAAGCTGGCACCAGAGACCCGATAGGGACTTATTAACTATATTGAACATTTTTTCCTTTGCCTTTGACCCTATGTATAGTTACGATGCCAGATTAGATTTATAGCAGCCTCAAGTTGTATTAAATGATATTTTGCTTCCTGTAATACTATTATAAAATAAAGTTTGTTTATTCTCTAAACTTGTCACTTCTCTTTTTCTAAAGGGTTAAAAAAACA