Transcript asmbl_121083

Sequence
Transcript Sequence for observation asmbl_121083 of TGE0059550:
GCCGGCCCTCAGAGTCCTCTGACGGCCCCAGTCAGGGAATTTCAATTTGAAACCTAGCGGAGGGAGGAGGCAGGCGCGGCTGCCGGCGGCTGGGACTGAAGAGGGACGGGTCCCGCGGCGAGCGAGCTCCTGAGCATAAGCTGTGGCCATGACTACTGAAGTAGGCTCTGTGTCTGAAGTGAAGAAGGACTCTAGCCAGTTAGGAACAGATGCAACCAAGGAAAAACCTAAAGAAGTAGCAGAAAATCAGCAGAATCAGTCTTCCGATCCAGAGGAGGAAAAAGGTTCCCAGCCACCTCCTGCAGCTGAAAGCCAAAGTAGTCTACGCCGCCAGAAGAGAGAGAAGGAAACATCGGAGAGCAGGGGTATTTCTCGGTTCATACCGCCATGGCTTAAGAAGCAAAAGTCATATACCTTAGTAGTGGCCAAAGATGGAGGAGATAAAAAAGAGCCTACCCAAGCTGTTGTTGAAGAACAGGTCTTAGATAAAGAGGAACCCCTTCCAGAAGAACAGAGACAGGCTAAGGGTGATGCTGAAGAAATGGCTCAGAAGAAACAAGAGATTAAAGTTGAAGTCAAGGAAGAAAAACCCTCAGTGAGCAAGGAAGAAAAACCCTCAGTGAGCAAAGTGGAGATGCAGCCTACTGAATTAGTAAGTAAGGAGAGAGAAGAGAAGGTAAAAGAAACACAGGAAGACAAATTAGAAGGAGGAGCAGCAAAAAGGGAGACCAAGGAAGTGCAGACCAATGAGCTGAAAGCAGAGAAGGCATCTCAAAAAGTCACCAAGAAGACCAAAACTGTCCAGTGTAAAGTGACCCTCTTAGATGGCACCGAATACAGCTGTGACCTGGAGAAACATGCCAAGGGACAAGTGTTATTTGACAAAGTGTGTGAACACCTCAATCTCTTGGAGAAAGACTACTTTGGACTTTTGTTTCAGGAAAGCCCTGAGCAGAAAAACTGGTTAGATCCTGCTAAAGAAATAAAGAGACAACTGAGAAACCTTCCATGGCTATTCACTTTTAATGTGAAGTTTTATCCTCCTGATCCTTCTCAATTGACTGAAGATATCACCAGATACTTCTTGTGCCTTCAGCTCCGGCAGGACATTGCCTCTGGCCGCCTGCCCTGCTCTTTTGTGACTCATGCTCTCCTGGGATCCTACACCCTGCAGGCTGAACTTGGTGACTATGACCCAGAAGAACATGGCAGCATCGACCTCAGTGAATTCCAGTTTGCCCCTACTCAGACTAAGGAGCTGGAAGAGAAGGTGGCAGAGCTGCACAAAACCCACAGGGGCTTATCGCCAGCACAAGCTGATTCCCAGTTCTTAGAAAATGCAAAGAGGCTTTCCATGTATGGTGTTGACCTACATCATGCCAAGGACTCAGAAGGTGTGGACATCAAGCTGGGCGTGTGTGCTAATGGACTTCTCATTTACAAAGACAGACTGCGAATCAATCGTTTTGCTTGGCCGAAAATCTTAAAAATTTCCTATAAACGCAGTAACTTCTACATTAAAGTCAGACCGGCAGAGCTGGAACAGTTTGAGAGTACCATTGGATTCAAACTGCCAAACCACCGGGCAGCGAAAAGACTATGGAAAGTGTGCGTGGAGCATCATACTTTCTACAGGCTTGTTTCTCCAGAGCAGCCACCAAAAGCCAAGTTCCTGACCTTGGGGTCCAAATTTCGCTATAGTGGCCGCACCCAAGCACAGACCCGCCAGGCCAGCACCCTCATAGATAGGCCAGCACCACACTTTGAGCGCACTTCTAGTAAACGGGTCTCCAGGAGTCTAGATGGAGCTCCGATTGGTGTCATGGACCAAAGTCTTATGAAGGATTTTCCTGGCGCTGCTGGGGAGATTTCAGCCTATGGACCTGGACTTGTCAGCATTGCCGTGGTACAAGATGGGGACGGCAGGAGGGAAGTGAGAAGCCCAACTAAAGCCCCACATTTGCAGCTCATTGAAGGAAAGAGTTCACATGAGACTCTGAATATAGTGGAGGAGAAGAAGCGGGCAGAGGTTGGGAAAGACGAAAGAGTAATCACAGAAGAAATGAATGGTAAAGAGATATCACCTGGGAGTGGTCCTGGGGAGATTCGTAAGGTGGAGCCTGTGACACAAAAAGACTCCACCTCCCTGTCTTCTGAGAGCAGCAGCAGCAGCAGTGAGAGTGAGGAGGAAGACGTGGGAGAGTACCGTCCCCACCACCGAGTGACCGAGGGCACCATCAGGGAGGAACAGGAGTATGAAGAAGAGGTGGAGGAAGAACCCCGCCCGGCAGCCAAGGTAGTAGAGAGGGAGGAAGCAGTGCCCGAAGCCAGCCCAGTCACACAAGCAGGTGCCAGTGTAATCACAGTAGAAACAGTGATCCAGGAAAATGTAGGTGCCCAAAAGATACCCGGAGAGAAGAGTGTACACGAAGGCGCTCTTAAGCAAGACATGGGAGAAGAAGCAGAGGAAGAGCCACAGAAAGTTAACGGAGAGGTGTCCCATGTTGACATTGATGTTTTGCCACAAATTATTTGTTGTTCAGAGCCACCAGTGGTAAAAACAGAGATGGTAACAATTTCTGATGCCTCACAAAGGACAGAAATCTCCACCAAGGAAGTCCCCATTGTCCAAACTGAGACCAAAACCATCACATATGAGTCTCCACAGATTGATGGCGGGGCTGGTGGTGATTCGGGCACGTTACTGACCGCACAAACCATCACATCTGAGTCCGTGTCAACAACGACAACCACACACATCACCAAGACTGTAAAAGGTGGAATTTCTGAAACAAGAATTGAGAAACGCATTGTGATCACAGGAGATGGAGATATTGATCATGACCAGGCACTGGCTCAGGCGATCAGGGAAGCCAGAGAGCAGCACCCTGACATGTCGGTCACAAGAGTGGTGGTACACAAAGAAACAGAGTTGGCTGAGGAAGGGGAAGATTAAGTAAGAAAGTCATTTTTTAAACAACACTCAACTTTGTGAACCCCTGAAGATTTTTTGACCGTTCCAAGTCTTAATGCCACACCACTATTCCAGCGAATTTATGCTACAACTGGTAACAATGACCAGAAGCCTGAAGAATTAAAATGCCAACACCAAACCTTTCCTTACCAGCTCTGGTCTATATTGCTCCCATGCATTTAATATATTATTTTGTTTTATAACCACTTCTAAATATTCTCAGTTCTTTCTTTTTGTTGTTGTTAATTAAGGGGTTTTGGTTTTGTTTTCTGTTTACTTTGTGTGCAACTACCTGCTTTTAATGACTCACTTTGATCAAATGACAGTGAACAAAGCCAGCCCAAGCTGGTAAGGTGCTGTTCACTTGAACAGGTGCTGTTGCGCAGAAAGGAAACTCTGTGACTAATTTAGATAGTGGCTTTCCTTCTTCTGGATTCTTTTCATTGAATTCTCACAGTAAATATTTACGGAGTTTTCAAATTGCAGCAAATATACTGTATGAGAAAATATTAATACAGATTAAAAGCCTTTCTTACATCTTGAAAATTTTCTAATATTTGAGAATTTCACAGGGATGTTTTTTATATTGGACCCTTTTGACTTTCCAGTCCTGTGACTTTCTACTTTTAGTAGAGAGTCAGAATCTCTGGACTGGAGAATAATGAAGAAGTTCACTGACTGTGCACTGTGCTTAGAGACCCTGCCGCACCACAGTGCCAATGCTTGTCAGACACATGCCCTTCGGCAGCATTCCAGAACAGGAGGGAAGAGAAAGAGAAAACTTTCTTCCCTTCTACTAAAAGATTCAGGCAGCTTAAAACCTTAGTGCTTTCTTTCTTAACATACCCACATTTCAATTCTTTCCATTATTTGAACACTTGGGTAGAACTCTTGCTTTGTATTAAACCTCTTTGTCTACACATGTAAAACTTACCTTTTGTTATTGAGCAGGCCTATCTCTTTCAGATAGTTTTATGATTCACACAGGTTTGAGGATGCTGGGGAGAGGGGGAGGGGGCTGTGGTGGTGTTCTGTTGGTTACAAGAAAGTTATACCATTTAAAGCTGGCACCAGAGACCCGATAGGGACTTATTAACTATATTGAACATTTTTTCCTTTGCCTTTGACCCTATGTATAGTTACGATGCCAGATTAGATTTATAGCAGCCTCAAGTTGTATTAAATGATATTTTGCTTCCTGTAATACTATTATAAAATAAAGTTTGTTTATTCTCTAAACTTGTCACTTCTCTTTTTCTAAAGGGTTAAAAAAACA