Transcript asmbl_121082

Sequence
Transcript Sequence for observation asmbl_121082 of TGE0059549:
GCCGGCCCTCAGAGTCCTCTGACGGCCCCAGTCAGGGAATTTCAATTTGAAACCTAGCGGAGGGAGGAGGCAGGCGCGGCTGCCGGCGGCTGGGACTGAAGAGGGACGGGTCCCGCGGCGAGCGAGCTCCTGAGCATAAGCTGTGGCCATGACTACTGAAGTAGGCTCTGTGTCTGAAGTGAAGAAGGACTCTAGCCAGTTAGGAACAGATGCAACCAAGGAAAAACCTAAAGAAGTAGCAGAAAATCAGCAGAATCAGTCTTCCGATCCAGAGGAGGAAAAAGGTTCCCAGCCACCTCCTGCAGCTGAAAGCCAAAGTAGTCTACGCCGCCAGAAGAGAGAGAAGGAAACATCGGAGAGCAGGGGTATTTCTCGGTTCATACCGCCATGGCTTAAGAAGCAAAAGTCATATACCTTAGTAGTGGCCAAAGATGGAGGAGATAAAAAAGAGCCTACCCAAGCTGTTGTTGAAGAACAGGTCTTAGATAAAGAGGAACCCCTTCCAGAAGAACAGAGACAGGCTAAGGGTGATGCTGAAGAAATGGCTCAGAAGAAACAAGAGATTAAAGTTGAAGTCAAGGAAGAAAAACCCTCAGTGAGCAAGGAAGAAAAACCCTCAGTGAGCAAAGTGGAGATGCAGCCTACTGAATTAGTAAGTAAGGAGAGAGAAGAGAAGGTAAAAGAAACACAGGAAGACAAATTAGAAGGAGGAGCAGCAAAAAGGGAGACCAAGGAAGTGCAGACCAATGAGCTGAAAGCAGAGAAGGCATCTCAAAAAGTCACCAAGAAGACCAAAACTGTCCAGTGTAAAGTGACCCTCTTAGATGGCACCGAATACAGCTGTGACCTGGAGAAACATGCCAAGGGACAAGTGTTATTTGACAAAGTGTGTGAACACCTCAATCTCTTGGAGAAAGACTACTTTGGACTTTTGTTTCAGGAAAGCCCTGAGCAGAAAAACTGGTTAGATCCTGCTAAAGAAATAAAGAGACAACTGAGAAACCTTCCATGGCTATTCACTTTTAATGTGAAGTTTTATCCTCCTGATCCTTCTCAATTGACTGAAGATATCACCAGATACTTCTTGTGCCTTCAGCTCCGGCAGGACATTGCCTCTGGCCGCCTGCCCTGCTCTTTTGTGACTCATGCTCTCCTGGGATCCTACACCCTGCAGGCTGAACTTGGTGACTATGACCCAGAAGAACATGGCAGCATCGACCTCAGTGAATTCCAGTTTGCCCCTACTCAGACTAAGGAGCTGGAAGAGAAGGTGGCAGAGCTGCACAAAACCCACAGGGGCTTATCGCCAGCACAAGCTGATTCCCAGTTCTTAGAAAATGCAAAGAGGCTTTCCATGTATGGTGTTGACCTACATCATGCCAAGGACTCAGAAGGTGTGGACATCAAGCTGGGCGTGTGTGCTAATGGACTTCTCATTTACAAAGACAGACTGCGAATCAATCGTTTTGCTTGGCCGAAAATCTTAAAAATTTCCTATAAACGCAGTAACTTCTACATTAAAGTCAGACCGGCAGAGCTGGAACAGTTTGAGAGTACCATTGGATTCAAACTGCCAAACCACCGGGCAGCGAAAAGACTATGGAAAGTGTGCGTGGAGCATCATACTTTCTACAGGCTTGTTTCTCCAGAGCAGCCACCAAAAGCCAAGTTCCTGACCTTGGGGTCCAAATTTCGCTATAGTGGCCGCACCCAAGCACAGACCCGCCAGGCCAGCACCCTCATAGATAGGCCAGCACCACACTTTGAGCGCACTTCTAGTAAACGGGTCTCCAGGAGTCTAGATGGAGCTCCGATTGGTGTCATGGACCAAAGTCTTATGAAGGATTTTCCTGGCGCTGCTGGGGAGATTTCAGCCTATGGACCTGGACTTGTCAGCATTGCCGTGGTACAAGATGGGGACGGCAGGAGGGAAGTGAGAAGCCCAACTAAAGCCCCACATTTGCAGCTCATTGAAGGAAAGAAAAATTCCTTGAGAGTAGAAGGGGATAATATTTATGTCAGACATAGCAATTTAATGTTGGAGGAACTGGATAAGGCCCAGGAGGACATACTGAAACATCAGGCTAGCATTAGTGAACTCAAGCGCAATTTTATGGAATCCACACCTGAGCCGCGCCCTAATGAATGGGAAAAACGACGTATCACACCTCTGTCCCTACAGACACAAGGGAGAAAAGGAGACCATCTTTTCAAGGATATTTTATCCGTGAAGGAGAAGTACCTGATGCCGACAATATGGACAGTTGAAGAAAAAGCTCAGGAGACGGACAAGACACGTGCTCCCGAGTCAGAAGGGCCTTGCACTGGAGCCAGGGATGCTGTTAAGAGTTCACATGAGACTCTGAATATAGTGGAGGAGAAGAAGCGGGCAGAGGTTGGGAAAGACGAAAGAGTAATCACAGAAGAAATGAATGGTAAAGAGATATCACCTGGGAGTGGTCCTGGGGAGATTCGTAAGGTGGAGCCTGTGACACAAAAAGACTCCACCTCCCTGTCTTCTGAGAGCAGCAGCAGCAGCAGTGAGAGTGAGGAGGAAGACGTGGGAGAGTACCGTCCCCACCACCGAGTGACCGAGGGCACCATCAGGGAGGAACAGGAGTATGAAGAAGAGGTGGAGGAAGAACCCCGCCCGGCAGCCAAGGTAGTAGAGAGGGAGGAAGCAGTGCCCGAAGCCAGCCCAGTCACACAAGCAGGTGCCAGTGTAATCACAGTAGAAACAGTGATCCAGGAAAATGTAGGTGCCCAAAAGATACCCGGAGAGAAGAGTGTACACGAAGGCGCTCTTAAGCAAGACATGGGAGAAGAAGCAGAGGAAGAGCCACAGAAAGTTAACGGAGAGGTGTCCCATGTTGACATTGATGTTTTGCCACAAATTATTTGTTGTTCAGAGCCACCAGTGGTAAAAACAGAGATGGTAACAATTTCTGATGCCTCACAAAGGACAGAAATCTCCACCAAGGAAGTCCCCATTGTCCAAACTGAGACCAAAACCATCACATATGAGTCTCCACAGATTGATGGCGGGGCTGGTGGTGATTCGGGCACGTTACTGACCGCACAAACCATCACATCTGAGTCCGTGTCAACAACGACAACCACACACATCACCAAGACTGTAAAAGGTGGAATTTCTGAAACAAGAATTGAGAAACGCATTGTGATCACAGGAGATGGAGATATTGATCATGACCAGGCACTGGCTCAGGCGATCAGGGAAGCCAGAGAGCAGCACCCTGACATGTCGGTCACAAGAGTGGTGGTACACAAAGAAACAGAGTTGGCTGAGGAAGGGGAAGATTAAGTAAGAAAGTCATTTTTTAAACAACACTCAACTTTGTGAACCCCTGAAGATTTTTTGACCGTTCCAAGTCTTAATGCCACACCACTATTCCAGCGAATTTATGCTACAACTGGTAACAATGACCAGAAGCCTGAAGAATTAAAATGCCAACACCAAACCTTTCCTTACCAGCTCTGGTCTATATTGCTCCCATGCATTTAATATATTATTTTGTTTTATAACCACTTCTAAATATTCTCAGTTCTTTCTTTTTGTTGTTGTTAATTAAGGGGTTTTGGTTTTGTTTTCTGTTTACTTTGTGTGCAACTACCTGCTTTTAATGACTCACTTTGATCAAATGACAGTGAACAAAGCCAGCCCAAGCTGGTAAGGTGCTGTTCACTTGAACAGGTGCTGTTGCGCAGAAAGGAAACTCTGTGACTAATTTAGATAGTGGCTTTCCTTCTTCTGGATTCTTTTCATTGAATTCTCACAGTAAATATTTACGGAGTTTTCAAATTGCAGCAAATATACTGTATGAGAAAATATTAATACAGATTAAAAGCCTTTCTTACATCTTGAAAATTTTCTAATATTTGAGAATTTCACAGGGATGTTTTTTATATTGGACCCTTTTGACTTTCCAGTCCTGTGACTTTCTACTTTTAGTAGAGAGTCAGAATCTCTGGACTGGAGAATAATGAAGAAGTTCACTGACTGTGCACTGTGCTTAGAGACCCTGCCGCACCACAGTGCCAATGCTTGTCAGACACATGCCCTTCGGCAGCATTCCAGAACAGGAGGGAAGAGAAAGAGAAAACTTTCTTCCCTTCTACTAAAAGATTCAGGCAGCTTAAAACCTTAGTGCTTTCTTTCTTAACATACCCACATTTCAATTCTTTCCATTATTTGAACACTTGGGTAGAACTCTTGCTTTGTATTAAACCTCTTTGTCTACACATGTAAAACTTACCTTTTGTTATTGAGCAGGCCTATCTCTTTCAGATAGTTTTATGATTCACACAGGTTTGAGGATGCTGGGGAGAGGGGGAGGGGGCTGTGGTGGTGTTCTGTTGGTTACAAGAAAGTTATACCATTTAAAGCTGGCACCAGAGACCCGATAGGGACTTATTAACTATATTGAACATTTTTTCCTTTGCCTTTGACCCTATGTATAGTTACGATGCCAGATTAGATTTATAGCAGCCTCAAGTTGTATTAAATGATATTTTGCTTCCTGTAATACTATTATAAAATAAAGTTTGTTTATTCTCTAAACTTGTCACTTCTCTTTTTCTAAAGGGTTAAAAAAACA