Transcript asmbl_121079

Sequence
Transcript Sequence for observation asmbl_121079 of TGE0059547:
CAGTCTTGCTCGTTAAGCTTTTGGACGCTGGATTTCCATCAGCTTTCCACAGTTTTCCAATGACAGGAAATAGCAGACAGCGGGCTTGATGTGCTTAAAAGCTGCCATAAGCTGTGGCCATGACTACTGAAGTAGGCTCTGTGTCTGAAGTGAAGAAGGACTCTAGCCAGTTAGGAACAGATGCAACCAAGGAAAAACCTAAAGAAGTAGCAGAAAATCAGCAGAATCAGTCTTCCGATCCAGAGGAGGAAAAAGGTTCCCAGCCACCTCCTGCAGCTGAAAGCCAAAGTAGTCTACGCCGCCAGAAGAGAGAGAAGGAAACATCGGAGAGCAGGGGTATTTCTCGGTTCATACCGCCATGGCTTAAGAAGCAAAAGTCATATACCTTAGTAGTGGCCAAAGATGGAGGAGATAAAAAAGAGCCTACCCAAGCTGTTGTTGAAGAACAGGTCTTAGATAAAGAGGAACCCCTTCCAGAAGAACAGAGACAGGCTAAGGGTGATGCTGAAGAAATGGCTCAGAAGAAACAAGAGATTAAAGTTGAAGTCAAGGAAGAAAAACCCTCAGTGAGCAAGGAAGAAAAACCCTCAGTGAGCAAAGTGGAGATGCAGCCTACTGAATTAGTAAGTAAGGAGAGAGAAGAGAAGGTAAAAGAAACACAGGAAGACAAATTAGAAGGAGGAGCAGCAAAAAGGGAGACCAAGGAAGTGCAGACCAATGAGCTGAAAGCAGAGAAGGCATCTCAAAAAGTCACCAAGAAGACCAAAACTGTCCAGTGTAAAGTGACCCTCTTAGATGGCACCGAATACAGCTGTGACCTGGAGAAACATGCCAAGGGACAAGTGTTATTTGACAAAGTGTGTGAACACCTCAATCTCTTGGAGAAAGACTACTTTGGACTTTTGTTTCAGGAAAGCCCTGAGCAGAAAAACTGGTTAGATCCTGCTAAAGAAATAAAGAGACAACTGAGAAACCTTCCATGGCTATTCACTTTTAATGTGAAGTTTTATCCTCCTGATCCTTCTCAATTGACTGAAGATATCACCAGATACTTCTTGTGCCTTCAGCTCCGGCAGGACATTGCCTCTGGCCGCCTGCCCTGCTCTTTTGTGACTCATGCTCTCCTGGGATCCTACACCCTGCAGGCTGAACTTGGTGACTATGACCCAGAAGAACATGGCAGCATCGACCTCAGTGAATTCCAGTTTGCCCCTACTCAGACTAAGGAGCTGGAAGAGAAGGTGGCAGAGCTGCACAAAACCCACAGGGGCTTATCGCCAGCACAAGCTGATTCCCAGTTCTTAGAAAATGCAAAGAGGCTTTCCATGTATGGTGTTGACCTACATCATGCCAAGGACTCAGAAGGTGTGGACATCAAGCTGGGCGTGTGTGCTAATGGACTTCTCATTTACAAAGACAGACTGCGAATCAATCGTTTTGCTTGGCCGAAAATCTTAAAAATTTCCTATAAACGCAGTAACTTCTACATTAAAGTCAGACCGGCAGAGCTGGAACAGTTTGAGAGTACCATTGGATTCAAACTGCCAAACCACCGGGCAGCGAAAAGACTATGGAAAGTGTGCGTGGAGCATCATACTTTCTACAGGCTTGTTTCTCCAGAGCAGCCACCAAAAGCCAAGTTCCTGACCTTGGGGTCCAAATTTCGCTATAGTGGCCGCACCCAAGCACAGACCCGCCAGGCCAGCACCCTCATAGATAGGCCAGCACCACACTTTGAGCGCACTTCTAGTAAACGGGTCTCCAGGAGTCTAGATGGAGCTCCGATTGGTGTCATGGACCAAAGTCTTATGAAGGATTTTCCTGGCGCTGCTGGGGAGATTTCAGCCTATGGACCTGGACTTGTCAGCATTGCCGTGGTACAAGATGGGGACGGCAGGAGGGAAGTGAGAAGCCCAACTAAAGCCCCACATTTGCAGCTCATTGAAGGAAAGAAAAATTCCTTGAGAGTAGAAGGGGATAATATTTATGTCAGACATAGCAATTTAATGTTGGAGGAACTGGATAAGGCCCAGGAGGACATACTGAAACATCAGGCTAGCATTAGTGAACTCAAGCGCAATTTTATGGAATCCACACCTGAGCCGCGCCCTAATGAATGGGAAAAACGACGTATCACACCTCTGTCCCTACAGACACAAGGGAGTTCACATGAGACTCTGAATATAGTGGAGGAGAAGAAGCGGGCAGAGGTTGGGAAAGACGAAAGAGTAATCACAGAAGAAATGAATGGTAAAGAGATATCACCTGGGAGTGGTCCTGGGGAGATTCGTAAGGTGGAGCCTGTGACACAAAAAGACTCCACCTCCCTGTCTTCTGAGAGCAGCAGCAGCAGCAGTGAGAGTGAGGAGGAAGACGTGGGAGAGTACCGTCCCCACCACCGAGTGACCGAGGGCACCATCAGGGAGGAACAGGAGTATGAAGAAGAGGTGGAGGAAGAACCCCGCCCGGCAGCCAAGGTAGTAGAGAGGGAGGAAGCAGTGCCCGAAGCCAGCCCAGTCACACAAGCAGGTGCCAGTGTAATCACAGTAGAAACAGTGATCCAGGAAAATGTAGGTGCCCAAAAGATACCCGGAGAGAAGAGTGTACACGAAGGCGCTCTTAAGCAAGACATGGGAGAAGAAGCAGAGGAAGAGCCACAGAAAGTTAACGGAGAGGTGTCCCATGTTGACATTGATGTTTTGCCACAAATTATTTGTTGTTCAGAGCCACCAGTGGTAAAAACAGAGATGGTAACAATTTCTGATGCCTCACAAAGGACAGAAATCTCCACCAAGGAAGTCCCCATTGTCCAAACTGAGACCAAAACCATCACATATGAGTCTCCACAGATTGATGGCGGGGCTGGTGGTGATTCGGGCACGTTACTGACCGCACAAACCATCACATCTGAGTCCGTGTCAACAACGACAACCACACACATCACCAAGACTGTAAAAGGTGGAATTTCTGAAACAAGAATTGAGAAACGCATTGTGATCACAGGAGATGGAGATATTGATCATGACCAGGCACTGGCTCAGGCGATCAGGGAAGCCAGAGAGCAGCACCCTGACATGTCGGTCACAAGAGTGGTGGTACACAAAGAAACAGAGTTGGCTGAGGAAGGGGAAGATTAAGTAAGAAAGTCATTTTTTAAACAACACTCAACTTTGTGAACCCCTGAAGATTTTTTGACCGTTCCAAGTCTTAATGCCACACCACTATTCCAGCGAATTTATGCTACAACTGGTAACAATGACCAGAAGCCTGAAGAATTAAAATGCCAACACCAAACCTTTCCTTACCAGCTCTGGTCTATATTGCTCCCATGCATTTAATATATTATTTTGTTTTATAACCACTTCTAAATATTCTCAGTTCTTTCTTTTTGTTGTTGTTAATTAAGGGGTTTTGGTTTTGTTTTCTGTTTACTTTGTGTGCAACTACCTGCTTTTAATGACTCACTTTGATCAAATGACAGTGAACAAAGCCAGCCCAAGCTGGTAAGGTGCTGTTCACTTGAACAGGTGCTGTTGCGCAGAAAGGAAACTCTGTGACTAATTTAGATAGTGGCTTTCCTTCTTCTGGATTCTTTTCATTGAATTCTCACAGTAAATATTTACGGAGTTTTCAAATTGCAGCAAATATACTGTATGAGAAAATATTAATACAGATTAAAAGCCTTTCTTACATCTTGAAAATTTTCTAATATTTGAGAATTTCACAGGGATGTTTTTTATATTGGACCCTTTTGACTTTCCAGTCCTGTGACTTTCTACTTTTAGTAGAGAGTCAGAATCTCTGGACTGGAGAATAATGAAGAAGTTCACTGACTGTGCACTGTGCTTAGAGACCCTGCCGCACCACAGTGCCAATGCTTGTCAGACACATGCCCTTCGGCAGCATTCCAGAACAGGAGGGAAGAGAAAGAGAAAACTTTCTTCCCTTCTACTAAAAGATTCAGGCAGCTTAAAACCTTAGTGCTTTCTTTCTTAACATACCCACATTTCAATTCTTTCCATTATTTGAACACTTGGGTAGAACTCTTGCTTTGTATTAAACCTCTTTGTCTACACATGTAAAACTTACCTTTTGTTATTGAGCAGGCCTATCTCTTTCAGATAGTTTTATGATTCACACAGGTTTGAGGATGCTGGGGAGAGGGGGAGGGGGCTGTGGTGGTGTTCTGTTGGTTACAAGAAAGTTATACCATTTAAAGCTGGCACCAGAGACCCGATAGGGACTTATTAACTATATTGAACATTTTTTCCTTTGCCTTTGACCCTATGTATAGTTACGATGCCAGATTAGATTTATAGCAGCCTCAAGTTGTATTAAATGATATTTTGCTTCCTGTAATACTATTATAAAATAAAGTTTGTTTATTCTCTAAACTTGTCACTTCTCTTTTTCTAAAGGGTTAAAAAAACA