Transcript asmbl_121078

Sequence
Transcript Sequence for observation asmbl_121078 of TGE0059547:
GCCGGCCCTCAGAGTCCTCTGACGGCCCCAGTCAGGGAATTTCAATTTGAAACCTAGCGGAGGGAGGAGGCAGGCGCGGCTGCCGGCGGCTGGGACTGAAGAGGGACGGGTCCCGCGGCGAGCGAGCTCCTGAGCATAAGCTGTGGCCATGACTACTGAAGTAGGCTCTGTGTCTGAAGTGAAGAAGGACTCTAGCCAGTTAGGAACAGATGCAACCAAGGAAAAACCTAAAGAAGTAGCAGAAAATCAGCAGAATCAGTCTTCCGATCCAGAGGAGGAAAAAGGTTCCCAGCCACCTCCTGCAGCTGAAAGCCAAAGTAGTCTACGCCGCCAGAAGAGAGAGAAGGAAACATCGGAGAGCAGGGGTATTTCTCGGTTCATACCGCCATGGCTTAAGAAGCAAAAGTCATATACCTTAGTAGTGGCCAAAGATGGAGGAGATAAAAAAGAGCCTACCCAAGCTGTTGTTGAAGAACAGGTCTTAGATAAAGAGGAACCCCTTCCAGAAGAACAGAGACAGGCTAAGGGTGATGCTGAAGAAATGGCTCAGAAGAAACAAGAGATTAAAGTTGAAGTCAAGGAAGAAAAACCCTCAGTGAGCAAGGAAGAAAAACCCTCAGTGAGCAAAGTGGAGATGCAGCCTACTGAATTAGTAAGTAAGGAGAGAGAAGAGAAGGTAAAAGAAACACAGGAAGACAAATTAGAAGGAGGAGCAGCAAAAAGGGAGACCAAGGAAGTGCAGACCAATGAGCTGAAAGCAGAGAAGGCATCTCAAAAAGTCACCAAGAAGACCAAAACTGTCCAGTGTAAAGTGACCCTCTTAGATGGCACCGAATACAGCTGTGACCTGGAGAAACATGCCAAGGGACAAGTGTTATTTGACAAAGTGTGTGAACACCTCAATCTCTTGGAGAAAGACTACTTTGGACTTTTGTTTCAGGAAAGCCCTGAGCAGAAAAACTGGTTAGATCCTGCTAAAGAAATAAAGAGACAACTGAGAAACCTTCCATGGCTATTCACTTTTAATGTGAAGTTTTATCCTCCTGATCCTTCTCAATTGACTGAAGATATCACCAGATACTTCTTGTGCCTTCAGCTCCGGCAGGACATTGCCTCTGGCCGCCTGCCCTGCTCTTTTGTGACTCATGCTCTCCTGGGATCCTACACCCTGCAGGCTGAACTTGGTGACTATGACCCAGAAGAACATGGCAGCATCGACCTCAGTGAATTCCAGTTTGCCCCTACTCAGACTAAGGAGCTGGAAGAGAAGGTGGCAGAGCTGCACAAAACCCACAGGGGCTTATCGCCAGCACAAGCTGATTCCCAGTTCTTAGAAAATGCAAAGAGGCTTTCCATGTATGGTGTTGACCTACATCATGCCAAGGACTCAGAAGGTGTGGACATCAAGCTGGGCGTGTGTGCTAATGGACTTCTCATTTACAAAGACAGACTGCGAATCAATCGTTTTGCTTGGCCGAAAATCTTAAAAATTTCCTATAAACGCAGTAACTTCTACATTAAAGTCAGACCGGCAGAGCTGGAACAGTTTGAGAGTACCATTGGATTCAAACTGCCAAACCACCGGGCAGCGAAAAGACTATGGAAAGTGTGCGTGGAGCATCATACTTTCTACAGGCTTGTTTCTCCAGAGCAGCCACCAAAAGCCAAGTTCCTGACCTTGGGGTCCAAATTTCGCTATAGTGGCCGCACCCAAGCACAGACCCGCCAGGCCAGCACCCTCATAGATAGGCCAGCACCACACTTTGAGCGCACTTCTAGTAAACGGGTCTCCAGGAGTCTAGATGGAGCTCCGATTGGTGTCATGGACCAAAGTCTTATGAAGGATTTTCCTGGCGCTGCTGGGGAGATTTCAGCCTATGGACCTGGACTTGTCAGCATTGCCGTGGTACAAGATGGGGACGGCAGGAGGGAAGTGAGAAGCCCAACTAAAGCCCCACATTTGCAGCTCATTGAAGGAAAGAAAAATTCCTTGAGAGTAGAAGGGGATAATATTTATGTCAGACATAGCAATTTAATGTTGGAGGAACTGGATAAGGCCCAGGAGGACATACTGAAACATCAGGCTAGCATTAGTGAACTCAAGCGCAATTTTATGGAATCCACACCTGAGCCGCGCCCTAATGAATGGGAAAAACGACGTATCACACCTCTGTCCCTACAGACACAAGGGAGTTCACATGAGACTCTGAATATAGTGGAGGAGAAGAAGCGGGCAGAGGTTGGGAAAGACGAAAGAGTAATCACAGAAGAAATGAATGGTAAAGAGATATCACCTGGGAGTGGTCCTGGGGAGATTCGTAAGGTGGAGCCTGTGACACAAAAAGACTCCACCTCCCTGTCTTCTGAGAGCAGCAGCAGCAGCAGTGAGAGTGAGGAGGAAGACGTGGGAGAGTACCGTCCCCACCACCGAGTGACCGAGGGCACCATCAGGGAGGAACAGGAGTATGAAGAAGAGGTGGAGGAAGAACCCCGCCCGGCAGCCAAGGTAGTAGAGAGGGAGGAAGCAGTGCCCGAAGCCAGCCCAGTCACACAAGCAGGTGCCAGTGTAATCACAGTAGAAACAGTGATCCAGGAAAATGTAGGTGCCCAAAAGATACCCGGAGAGAAGAGTGTACACGAAGGCGCTCTTAAGCAAGACATGGGAGAAGAAGCAGAGGAAGAGCCACAGAAAGTTAACGGAGAGGTGTCCCATGTTGACATTGATGTTTTGCCACAAATTATTTGTTGTTCAGAGCCACCAGTGGTAAAAACAGAGATGGTAACAATTTCTGATGCCTCACAAAGGACAGAAATCTCCACCAAGGAAGTCCCCATTGTCCAAACTGAGACCAAAACCATCACATATGAGTCTCCACAGATTGATGGCGGGGCTGGTGGTGATTCGGGCACGTTACTGACCGCACAAACCATCACATCTGAGTCCGTGTCAACAACGACAACCACACACATCACCAAGACTGTAAAAGGTGGAATTTCTGAAACAAGAATTGAGAAACGCATTGTGATCACAGGAGATGGAGATATTGATCATGACCAGGCACTGGCTCAGGCGATCAGGGAAGCCAGAGAGCAGCACCCTGACATGTCGGTCACAAGAGTGGTGGTACACAAAGAAACAGAGTTGGCTGAGGAAGGGGAAGATTAAGTAAGAAAGTCATTTTTTAAACAACACTCAACTTTGTGAACCCCTGAAGATTTTTTGACCGTTCCAAGTCTTAATGCCACACCACTATTCCAGCGAATTTATGCTACAACTGGTAACAATGACCAGAAGCCTGAAGAATTAAAATGCCAACACCAAACCTTTCCTTACCAGCTCTGGTCTATATTGCTCCCATGCATTTAATATATTATTTTGTTTTATAACCACTTCTAAATATTCTCAGTTCTTTCTTTTTGTTGTTGTTAATTAAGGGGTTTTGGTTTTGTTTTCTGTTTACTTTGTGTGCAACTACCTGCTTTTAATGACTCACTTTGATCAAATGACAGTGAACAAAGCCAGCCCAAGCTGGTAAGGTGCTGTTCACTTGAACAGGTGCTGTTGCGCAGAAAGGAAACTCTGTGACTAATTTAGATAGTGGCTTTCCTTCTTCTGGATTCTTTTCATTGAATTCTCACAGTAAATATTTACGGAGTTTTCAAATTGCAGCAAATATACTGTATGAGAAAATATTAATACAGATTAAAAGCCTTTCTTACATCTTGAAAATTTTCTAATATTTGAGAATTTCACAGGGATGTTTTTTATATTGGACCCTTTTGACTTTCCAGTCCTGTGACTTTCTACTTTTAGTAGAGAGTCAGAATCTCTGGACTGGAGAATAATGAAGAAGTTCACTGACTGTGCACTGTGCTTAGAGACCCTGCCGCACCACAGTGCCAATGCTTGTCAGACACATGCCCTTCGGCAGCATTCCAGAACAGGAGGGAAGAGAAAGAGAAAACTTTCTTCCCTTCTACTAAAAGATTCAGGCAGCTTAAAACCTTAGTGCTTTCTTTCTTAACATACCCACATTTCAATTCTTTCCATTATTTGAACACTTGGGTAGAACTCTTGCTTTGTATTAAACCTCTTTGTCTACACATGTAAAACTTACCTTTTGTTATTGAGCAGGCCTATCTCTTTCAGATAGTTTTATGATTCACACAGGTTTGAGGATGCTGGGGAGAGGGGGAGGGGGCTGTGGTGGTGTTCTGTTGGTTACAAGAAAGTTATACCATTTAAAGCTGGCACCAGAGACCCGATAGGGACTTATTAACTATATTGAACATTTTTTCCTTTGCCTTTGACCCTATGTATAGTTACGATGCCAGATTAGATTTATAGCAGCCTCAAGTTGTATTAAATGATATTTTGCTTCCTGTAATACTATTATAAAATAAAGTTTGTTTATTCTCTAAACTTGTCACTTCTCTTTTTCTAAAGGGTTAAAAAAACA