Transcript asmbl_121009

Sequence
Transcript Sequence for observation asmbl_121009 of TGE0056692:
ATATTCTTCTGGAGCCCTTGGAGGGGCTCCAAACTGAGAGGGGAGGGAAGACCGCAGGGAAAGGCGGACCTCAGTGTCTGAAAAGCCAGCTTAGAGTGGGAGGGCCTGGGAGTAGAAGGTAAAAAGGGAGTGGTGAGAATGAATGTGAGAAGGAAGCCAGGACAGCGCAGTCCCCAGTCCCGAACGGCCAGGGAGAGGAGGTGGCCTAGCGCTGGCGGGGCTCACCCCAATCCGTCTGCCTTTTGATGCCGTACTCTGCTGGTTGCGCAGCCACCTCGGGATACTGCACACGGAGAGGAGGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGCCCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGAAATGCAATGCTGGATTCTTTCACACCCTGTCGGGAGAATGTGTGCCCTGCGACTGTAATGGCAATTCCAACGAGTGTTTGGACGGCTCAGGATACTGTGTGCACTGCCAGCGGAACACAACAGGAGAGCACTGTGAAAAGTGTCTGGATGGTTATATCGGAGATTCCATCAGGGGAGCACCCCAATTCTGCCAGCCGTGCCCCTGTCCCCTGCCCCACTTGGCCAATTTTGCAGAATCCTGCTATAGGAAAAATGGAGCTGTTCGGTGCATTTGTAACGAAAATTATGCTGGACCTAACTGTGAAAGATGTGCTCCCGGTTACTATGGAAACCCCTTACTCATTGGAAGCACCTGTAAGAAATGTGACTGCAGTGGAAATTCAGATCCCAACCTGATCTTTGAAGATTGTGATGAAGTCACTGGCCAGTGTAGGAATTGCTTACGCAACACCACCGGATTCAAGTGTGAACGTTGCGCTCCTGGCTACTATGGGGACGCCAGGATAGCCAAGAACTGTGCAGTGTGCAACTGCGGGGGAGGCCCATGTGACAGTGTAACCGGAGAATGCTTGGAAGAAGGTTTTGAACCCCCTACAGGCTGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGGAAAATCAAGCCTCCAGAAAAGGACAACTTGTTCAGAAGGAAAGCATGGACACCATTAACCACGCAAGTCAGCTGGTAGAGCAAGCCCATGATATGAGGGATAAAATCCAAGAGATCAACAACAAGATGCTCTATTATGGGGAAGAGCATGAACTTAGCCCCAAGGAAATCTCTGAGAAGCTGGTGTTGGCCCAGAAGATGCTTGAAGAGATTAGAAGCCGTCAACCATTTTTCACCCAACGGGAGCTCGTGGATGAGGAGGCAGATGAGGCTTACGAACTACTGAGCCAGGCTGAGAGCTGGCAGCGGCTGCACAATGAGACCCGCACTCTGTTTCCTGTCGTCCTGGAGCAGCTGGATGACTACAATGCTAAGTTGTCAGATCTCCAGGAAGCACTTGACCAGGCCCTTAACTATGTCAGGGATGCCGAAGACATGAACAGGGCCACAGCAGCCAGGCAGCGGGACCATGAGGTACAGCGGACACTCACCATCAATGCATTTCAGCATCAGCAGTGTGATGGTACACCAAGAAGGGGCTGTTGATATAAATTTTTTTAAAATATTGGTATAGTTAAATACTTATATTTTAAAATATTGGTGTGTTTTTTGGTGCTATAAATTACTAACTTGTGTGTTCCTAAAATCAAGTTGAAACTAGGATAATTGTCTAGTTCTTGCTTTGATAAGAACGCAGTAGTTCTGATGCTTGTGTCCATGTGTATGGGTCTGTTATTCTTGCAAGTGGG