Transcript asmbl_120777

Sequence
Transcript Sequence for observation asmbl_120777 of TGE0056946:
CGCCACCTCACGCCGAAGGAATGCTCGAAGTATGCACACGTTCCCAAAAGTAGACCTCCTTCACCGCCGGAGGAGCATACATCACCCCGTGGCAGCCGTCCACCTTCTCAGGCGTTTCGTAACCGAGTAAACTGAGAGCTGGGAACAGCCCTCTATTAAGTAGCCCGCGGCGCGGAGTCTCTTTCCACTTGGCTAAGGCGAACCGCCCCAGACGCGTCCGCGCGCCGGCAGCTGCAGGCTCAGGCCATCTCCAGTCTTCCTGCCGCGCCCGCCTCTCCTCCTGGGATTCTCCTCCTCCTCCTGGACTTCCCCGCAGCTGCCCACGCCTCGGCGGCCGCCAGGTGCTCCTGGAGTGCAGCGCCTATCGCCGGGGCGTGTGGGGGCCACACCGAGCACCAGCTTCTCCGACGCCGGGAAGCCGCTGTCGCCGCCGCTACCTCTCCCTGTTGCCGCCGCCTCAGATCTCTTCATGCCGCTGTAAGCTCGGAGGCCAAGGATGCGGAGTAGGCTTCCCCCAGCGCTTGCCGCCCTGGGCGCGGCCCTGCTCCTGTCTTCCATTGAGGCAGAAGTTGACCCACCTTCAGACTTGAATTTTAAAATTATAGATGAAAATACTGTTCATATGTCATGGGCAAAACCAGTTGATCCAATTGTGGGTTACAGAATAACGGTGGACCCTACAACGGATGGGCCTACTAAAGAATTTACCCTTTCAGCTAGTACCACTGAAACTTTATTGTCAGAACTTGTACCTGAAACAGAGTATGTGGTGACAATAACTTCATATGATGAAGTAGAAGAAAGTGTACCAGTTATAGGACAACTAACAATTCAAACAGGTAGTTCGACAAAGCCAGTGGAGAAGAAACCTGGAAAAACCGAGATACAAAAATGCTCTGTCAGTGCCTGGACTGATTTGGTTTTCCTCGTGGATGGCTCTTGGAGTGTGGGAAGAAATAATTTCAAGTACATTTTAGACTTCATTGCTGCTCTTGTGTCTGCTTTTGACATTGGGGAAGAGAAGACAAGAGTTGGAGTTGTTCAATACAGCTCTGATACCAGGACTGAATTTAACTTAAATCAGTACTACCAAAGGGATGAACTTCTTGCTGCAATAAAAAAAATTCCATATAAAGGTGGCAACACAATGACAGGGGATGCCATTGATTATTTAGTTAAAAATACTTTCACGGAATCTGCTGGGGCAAGAGTTGGCTTTCCTAAAGTGGCAATTATTATTACGGATGGAAAATCCCAGGATGAAGTGGAAATTCCAGCAAGAGAGCTTCGTAATGTTGGAGTTGAAGTTTTCTCCTTGGGCATTAAAGCTGCAGATGCAAAAGAACTCAAACAAATTGCCTCCACACCTTCACTGAACCATGTTTTCAATGTGGCCAACTTTGATGCAATTGTGGATATTCAGAATGAGATCATCTCCCAGGTGTGCTCAGGTGTTGATGAACAACTTGGTGAATTGGTTAGTGGAGAAGAAGTTGTTGAGCCTCCTTCAAATTTGATTGCCATGGAAGTCTCTTCAAAATATGTTAAGCTAAATTGGAATCCATCTCCTAGTCCAGTGACTGGCTACAAAGTCATCCTCACACCAATGACTGCAGGAAGCCGACAGCACGCTCTGAGTGTGGGGCCTCAGACAACCACGCTCAGTGTTCGCGACCTCTCAGCAGACACAGAATACCAGATCAGTGTTTCCGCCATGAAGGGAATGACATCCAGTGAACCCATTTCAATAATGGAGAAGACTCAGCCAATGAAAGTTCAAGTGGAATGCTCACGTGGTGTGGATATAAAAGCCGATATTGTGTTTTTGGTTGATGGCTCCTATAGCATTGGGATTGCAAACTTTGTTAAAGTTAGAGCCTTTTTGGAAGTTCTTGTAAAAAGTTTTGAAATTTCACCAAATAGGGTCCAGATTAGTCTTGTGCAATACAGCCGGGATCCTCATACTGAGTTCACTTTGAAAAAATTCACCAAAGTTGAAGATATAATTGAAGCAATAAACACCTTCCCTTACAGAGGAGGATCTACAAATACTGGCAAAGCAATGACTTATGTCAGAGAGAAAATATTTGTGCCTAGCAAGGGATCAAGAAGCAATGTGCCAAAGGTCATGATTCTTATCACGGATGGGAAATCATCAGATGCTTTCAGAGATCCTGCGATAAAACTGAGGAATTCAGATGTTGAAATCTTTGCAGTTGGTGTGAAGGATGCCGTTCGCTCAGAATTGGAAGCTATTGCCTCTCCTCCTGCAGAGACCCATGTGTTCACAGTGGAAGATTTTGATGCTTTTCAGAGGATATCTTTTGAACTCACACAGTCTATCTGCCTTAGAATTGAGCAAGAATTGGCAGCTATAAAGAAGAAAGCTTACGTCCCTCCAAAGGATCTTAGTTTTTCAGAAGTGACTTCTTATGGTTTCAAAACCAACTGGTCTCCAGCTGGAGAAAATGTTTTTTCATATCACATCACCTACAAGGAAGCGGCTGGGGATGATGAGGTCACTGTGGTGGAGCCAGCATCGAGCACCAGTGTTGTTCTCAGCAGCCTGAAGCCAGAGACCTTGTATTTGGTCAATGTGACTGCGGAGTATGAGGATGGCTTCAGCATTCCCTTAGCTGGAGAGGAGACCACCGAAGAAGTAAAAGGAGCACCTCGAAACCTAAAGGTGACAGATGAGACTACAGATAGTTTCAAAATTACTTGGACTCAAGCTCCAGGGAGAGTTTTAAGATATCGAATTATATATAGACCAGTTGCTGGTGGAGAGAGCAGAGAAGTTACCACCCCACCCAATCAGAGGAGGAGAACACTGGAGAACTTGATTCCAGACACGAAATATGAAGTATCTGTAATTCCTGAATATTTCTCAGGACCTGGTACTCCATTAACTGGAAATGCAGCCACTGAAGAAGTTAGAGGGAATCCAAGAGACTTAAGAGTTTCTGACCCTACGACGTCTACTATGAAATTATCTTGGAGTGGGGCACCAGGAAAAGTGAAACAGTATCTCGTCACATATACCCCAGTGGCAGGGGGTGAAACTCAAGAGGTCACTGTGAGGGGAGATACAACCAATACGGTGCTGCAGGGATTGAAGGAAGGGACACAATACGCCTTATCTGTGACAGCCTTGTATGCGTCTGGGGCTGGAGACGCCCTCTTTGGTGAAGGAACAACACTTGAAGAACGTGGTTCTCCTCAAGATTTAGTTACTAAAGACATCACTGACACATCAATTGGGGCTTATTGGACATCTGCTCCAGGAATGGTTCGCGGTTACAGGGTCTCATGGAAATCACTTTATGATGATGTTGACACTGGAGAGAAAAATCTGCCTGAAGATGCAATTCATACGATGATAGAAAATCTGCAGCCAGAGACCAAATACAGAATTTCAGTATTTGCCACTTACAGCAGTGGAGAAGGAGAACCTTTGACTGGAGATGCCACAACTGAATTATCTCAAGATTCCAAAACCCTGAAAGTAGATGAAGAAACAGAAAACACAATGAGAGTTACATGGAAACCAGCACCAGGGAAAGTCGTCAACTACCGTGTTGTCTATCGCCCTCATGGGAGAGGGAAGCAAATGGTTGCTAAGGTGCCCCCCACAGTCACTTCGACAGTGTTAAAGCGACTTCAGCCACAGACCACATATGACATCACAGTTCTTCCTATTTACAAGATGGGAGAAGGAAAGCTTAGGCAAGGATCAGGAACAACAGCTTCTCGGTTTAAGTCTCCTAGAAACCTCAAAACATCTGACCCAACCATGTCAAGCTTCCGAGTGACTTGGGAGCCTGCCCCTGGGGAAGTGAAGGGTTATAAAGTCACATTCCACCCTACGGGGGATGACAGAAGACTGGGGGAGTTAGTGGTTGGACCCTATGACAACACAGTTGTTTTGGAGGAACTTAGGGCTGGTACCACCTATAAAGTAAATGTTTTTGGAATGTTTGATGGAGGAGAAAGCTCACCACTTGTTGGACAAGAAATGACAACCCTTTCCGACACAACTGTTATGCCAATTTTATCTTCTGGGATGGAGTGTCTCACCAGAGCTGAGGCAGACATTGTGTTGCTGGTGGATGGATCATGGAGCATCGGCCGGGCAAATTTTAGAACCGTGAGGAGTTTCATTTCTCGTATTGTGGAAGTCTTTGACATTGGCCCCAAAAGAGTACAAATTGCTCTTGCTCAGTATAGTGGGGATCCCAGAACAGAGTGGCAGTTAAATGCACACAGAGACAAGAAGAGCTTGTTGCAAGCTGTGGCAAACTTGCCGTACAAAGGAGGCAATACTCTCACAGGCATGGCTTTGAATTTCATTCGCCAACAGAACTTCAGGACCCAAGCTGGCATGAGACCTCGAGCTCGAAAAATTGGTGTGCTCATTACTGATGGAAAATCACAAGACGATGTTGAAGCACCTTCAAAGAAACTCAAGGATGAGGGAGTGGAGCTGTTTGCTATTGGTATTAAAAATGCTGATGAAGTCGAATTAAAGATGATTGCAACTGATCCTGATGATACCCATGCATACAATGTGGCAGATTTTGAGTCACTCTCCAGGATAGTGGATGATCTCACCATTAATTTGTGTAACAGTGTCAAAGGTCCAGGTGATTTGGAAGCACCTTCTAACTTAGTTATTTCTGAGCGAACCCATCGTTCTTTTAGAGTGAGCTGGACACCACCTTCTGACAGTGTGGATCGATATAAGGTGGAATACTATCCAGTTTCTGGAGGGAAACGTCAAGAATTTTATGTGAGTCGAATGGAAACTAGCACAGTGCTGAAAGATCTGAAACCTGAAACTGAATATGTTGTCAATGTGTATTCTGTGGTAGAAGATGAATATAGTGAGCCTCTGAAGGGGACAGAAAAAACCTTGCCAGTGCCTGTAGTCAGCCTGAATATTTATGATGTTGGCCCTACCACCATGCATGTGCAGTGGCAGCCTGTGGGAGGAGCTACTGGCTACATCTTGTCATACAAACCTGTTAAGGACACAGAGCCAACAAGACCCAAAGAGGTGCGTTTGGGGCCAACAGTGAATGACATGCAGCTGACTGACCTTGTTCCCAACACGGAGTATGCAGTCACAGTCCAGGCTGTCCTGCACGACCTCACTAGTGAACCTGTCACTGTTCGGGAAGTCACCTTGCCTTTACCCAGACCTCAGGATCTGAAACTCAGAGATGTGACTCACAGCACTATGAATGTCTTTTGGGAACCTGTGCCTGGAAAAGTGCGTAAATATATTGTTCGATACAAAACACCAGAAGAGGATGTCAAAGAGGTAGAGGTGGACAGATCAGAGACCAGCACTTCCCTCAAAGACCTCTTCTCACAGACCTTGTACACAGTCAGCGTTTCTGCAGTACATGACGAGGGGGAGTCTCCTCCAGTGACTGCTCAAGAAACTACCCGACCCGTGCCAGCCCCAACAAACTTAAAGATTACTGAAGTAACATCAGAGGGTTTCAGAGGGACTTGGGATCATGGAGCTTCAGATGTGTCTCTCTACAGAATAACTTGGGCACCTTTTGGAAGCTCAGATAAGATGGAGACCATCTTAAATGGAGATGAAAACACTTTGGTGTTCGAAAACCTGAACCCCAACACCATCTATGAAGTTTCCATTACTGCCATCTATCCTGATGAGTCAGAAAGTGATGACCTGATTGGCAGTGAGCGCACACTGCCTATCTTAACAACACAAGCTCCCAAAAGTGGCCCACGAAACCTTCAAGTGTACAATGCAACATCTAACAGCCTGACTGTTAAGTGGGATCCTGCTAGTGGTCGTGTGCAGAAATATAGGATCACTTATCAGCCTTCCACAGGGGAAGGCAATGAGCAAACGACCACAATAGGAGGACGGCAGAACAGTGTGGTCCTGCAGAAACTGAAGCCAGACACTCCTTACACTATCACCGTATCCTCTCTGTATCCTGATGGTGAAGGAGGTCGGATGACGGGAAGAGGCAAGACCAAACCTCTAAACACTGTAAGGAACCTGAGAGTGTATGACCCTTCTACCAGCACCTTGAATGTCCGCTGGGACCATGCAGAGGGAAATCCTCGTCAGTACAAGCTCTTCTATGCACCAGCAGCAGGTGGTCCAGAGGAACTGGTACCAATCCCCGGGAATACCAATTATGCCATTCTTAGGAATCTGCAGCCAGATACCTCATACACTGTGACTGTAGTTCCCGTTTATACTGAAGGTGATGGGGGACGCACATCAGATACTGGAAGGACATTGATGAGAGGACTGGCAAGAAATGTCCAAGTATACAATCCTACACCTAACAGCCTCGATGTTCGCTGGGACCCTGCTCCAGGACCTGTGCTGCAATATCGCGTTGTGTATTCTCCTGTGGATGGCACAAGACCCTCAGAATCTATAGTAGTGCCAGGAAACACGCGCATGGTGCATCTGGAGCGGCTGATTCCGGACACACTCTATTCCGTGAACCTTGTGGCTCTGTACTCGGATGGAGAGGGAAATCCCAGCCCTGCCCAGGGCCGAACGCTACCACGCAGTGGACCAAGGAACCTGAGAGTCTTTGGTGAAACAACCAATAGCCTCTCGGTAGCCTGGGATCATGCTGATGGGCCAGTTCAGCAGTACAGGATCATCTATTCTCCCACTGTTGGTGATCCAATTGATGAATATACCACAGTCCCAGGCAGAAGAAACAATGTAATACTGCAGCCCCTGCAACCTGACACTCCATATAAAATTACTGTTATTGCTGTTTATGAAGATGGAGATGGTGGCCATCTAACAGGAAATGGAAGAACTGTGGGACTCCTTCCTCCTCAGAACATACACATCTCTGACGAATGGTATACAAGATTCAGGGTGTCCTGGGATCCTTCACCTTCTCCAGTTCTTGGATATAAAATAGTATATAAGCCAGTGGGTTCCAATGAGCCCATGGAAGCCTTTGTTGGAGAAATGACATCATATACCTTACACAATCTCAATCCCAGCACCACCTACGATGTGAATGTTTATGCTCAATATGATTCTGGACTCAGTGTCCCCTTGACAGATCAAGGCACTACATTATATTTAAATGTAACAGATCTGAAAACTTACCAGATTGGGTGGGATACATTCTGTGTCAAATGGTCACCTCACCGGGCAGCCACCTCCTACAGGCTAAAACTAAGCCCTGCAGATGGAACAAGGGGACAAGAAATTACAGTGCGTGGATCAGAAACCAGTCACTGCTTCACTGGCCTTTCACCAGACACTGATTATGGTGTCACTGTTTTTGTGCAGACACCAAATCTCGAGGGACCAGGAGTCTCTGTTAAAGAACATACCACTGTGAAACCAACAGAAGCCCCTACAGAGCCACCCACACCTCCTCCCCCTCCCACCATTCCACCAGCCCGGGATGTATGCAAAGGGGCCAAGGCAGATATTGTGTTCTTGACTGATGCCTCCTGGAGCATTGGGGACGATAATTTTAACAAAGTTGTAAAATTCATCTTCAATACTGTGGGAGGCTTTGATGAAATCAGTCCTGCTGGGATTCAGGTTTCATTTGTGCAATACAGCGATGAGGTCAAGTCTGAGTTCAAGCTGAACACGTACAATGACAAGGCCCTAGCCCTTGGGGCCCTCCAGAATATTAGGTACAGAGGAGGAAACACAAGAACAGGCAAGGCCCTCACGTTTATCAAGGAGAAAGTCTTGACTTGGGAGAGCGGCATGAGGAAGAATGTCCCTAAGGTGTTGGTTGTGGTCACGGACGGTCGGTCCCAGGATGAGGTCAAGAAGGCGGCTTTGGTCATCCAGCAGTCAGGGTTCAGTGTCTTTGTAGTTGGTGTGGCTGATGTCGACTACAATGAGCTTGCCAACATTGCCAGCAAACCAAGTGAACGGCACGTGTTCATTGTGGACGACTTTGAATCTTTTGAGAAGATCGAAGACAATCTTATTACATTTGTTTGTGAAACTGCCACTTCAAGTTGTCCTCTCATTTATTTGGATGGCTACACCTCACCAGGTTTTAAAATGCTTGAAGCATACAACCTGACAGAAAAGAATTTTGCTTCTGTACAAGGAGTATCTTTGGAGTCAGGGTCTTTCCCCAGCTACTCAGCATACAGGATTCAGAAGAATGCGTTTGTGAATCAGCCTACAGCAGACCTACACCCAAATGGACTCCCTCCTTCATACACGATTATATTATTATTCAGACTTCTCCCAGAAACTCCCAGTGACCCTTTTGCAATTTGGCAAATCACAGACAGAGACTACAAACCACAAGTTGGAGTGATTGCAGATCCTTCTAGCAAGACGTTATCATTCTTTAACAAGGATACAAGAGGCGAGGTGCAAACTGTTACATTTGACACAGAAGAAGTAAAGACATTATTTTATGGAAGTTTTCACAAGGTTCATATTGTAGTGACCTCAAAAAGTGTTAAGATTTACATTGACTGCTATGAAATTATAGAAAAAGACATCAAGGAAGCTGGAAATATAACAACTGATGGTTATGAAATTCTTGGAAAACTCCTTAAAGGGGAAAGGAAATCAGCCGCATTCCAAATCCAGAGTTTTGACATTGTCTGCAGTCCAGTGTGGACCAGTAGAGACAGATGCTGTGATATTCCCTCTAGGAGAGATGAGGGAAAATGCCCTGCTTTTCCAAATTCTTGCACATGTACACAGGACAGCGTTGGACCTCCAGGACCTCCAGGCCCTGCAGGAGGACCTGGTGCTAAAGGTCCCAGAGGTGAAAGAGGTATCAGTGGGGCAATTGGGCCCCCTGGTCCTCGTGGAGACATAGGTCCTCCAGGCCCCCAGGGTCCTCCAGGCCCTCAGGGACCCAATGGACTCTCTATTCCGGGAGAGCAAGGTCGCCAAGGGATGAAAGGTGATGCTGGAGAGCCAGGACTTCCAGGCCGAACAGGAACCCCAGGATTACCTGGCCCACCAGGACCAATGGGACCTCCAGGAGACAGAGGCTTCACTGGAAAAGACGGTGCAATGGGACCCAGGGGCCCACCAGGGCCGCCGGGAAGCCCAGGCTCCCCAGGAGTCACAGGACCAAGTGGGAAGCCAGGAAAACCTGGAGATCATGGCAGACCAGGTCCATCTGGGTTGAAAGGAGAAAAAGGTGATAGGGGAGACATTGCTTCCCAGAACATGATGCGAGCAGTTGCAAGACAAGTCTGTGAACAATTGATAAGTGGTCAGATGAACAGATTCAATCAGATGCTGAATCAGATTCCAAATGATTACCAGTCCAGTCGCAACCAGCCAGGCCCGCCGGGTCCACCGGGACCTCCTGGTAGCGCAGGAGCCAGAGGAGAACCTGGGCCTGGGGGGCGGCCAGGCTTCCCGGGCACACCAGGGATGCAGGGACCCCCTGGGGAACGAGGTTTGCCAGGAGAGAAAGGTGAAAGGGGTACTGGATCTTCAGGACCTCGGGGGCTGCCTGGCCCCCCAGGTCCACAAGGAGAATCCAGAACAGGTCCACCAGGGTCCACAGGTTCAAGAGGTCCCCCTGGCCCCCCTGGCCGTCCTGGAAACTCAGGTATCCGAGGACCCCCAGGTCCTCCTGGATACTGTGATTCTTCTCAGTGTGCCAGCATCCCATACAACGGGCAAGGCTATCCAGAGCCTTACGTGCCCGAGGGCGGGGCCTACCTGCCTGAGCGCGAGCCCTTCATCGTGCCGGTGGAGCCCGAGCGGACAGCGGAATACGAGGACTACGGCGCAGACGAGCCTGCAGAGGAGCCTCCTGAGCCCCACCGGCGCTGGCGGCGCGCCCTGCCCCACGGACCCGGGCAGTGAACCAGAGATCACGCGCCGCGCCGCGAGGCTTGGGGGAGGTGTTGAAATTCTCATTTACAGGTCAGATAGAGCAGTGTACGTCTTTTCTGAGGTGTTTCTTCCAGCGTTGCTCATCCAGGAGTACCCTTTCTGATTGTAGAGAACCTTGTTTCTGCAGGAAGCCTAGCTCCAAGCACGCAGTCTGTAGACATTTTTGCCTTTGCCCTTGAAATGCTTGCAAAATACTTTGTTAACAAAAGCTGCAAAGAGAGAACATGCCGTGTGCCTTTAGTTAGCACAGCGGGCAGCCTCAGTGAAACTCTTAGGTTAAGCAGTTAAGTCCTGGAACCCAGAGCTGCTGTGTATTTCGAGCGGGCAGTTTATCTTTTGCTATACTTATTTTCAATTCAATTACACCACGATTCAAATAATTCCCCTCCTAAAACCAAAAAGGAGGGAAACGTCAACTCCATTGCAATTACTTATCTTCCTCTTCTATCTCTGTTATACGCCGGGGCATAGAATGCTCGTATACATCTCTTTAACAACCACAAACCTTAAGCCATGTAGATGAAGTTAGTGCATCAACGGGATACAGTTCCATATTGCCTTAAACCTCCTTGTTTTAGACACACTAACATTTATACCAAATTGCAGATTATTCTGCAGAGAGGGAATTGCATGTTTGTGTTGTATATTTAGTATGAACTTTTTTCAGAATATAATATTTCTTAGTTATCAAAAGTAGTTGGAAAACATTTGCAAGACTATGAACATAGAATTGCTGCTTTTATATTTTAACTGCAGATTGTGAATTTCACTGCCTTATATTATTTATTTCTGAAACAAAAGAGGCATTTTTCAATAAAACTACTGAAAATTTGA