Transcript asmbl_120774

Sequence
Transcript Sequence for observation asmbl_120774 of TGE0056946:
CGCCACCTCACGCCGAAGGAATGCTCGAAGTATGCACACGTTCCCAAAAGTAGACCTCCTTCACCGCCGGAGGAGCATACATCACCCCGTGGCAGCCGTCCACCTTCTCAGGCGTTTCGTAACCGAGTAAACTGAGAGCTGGGAACAGCCCTCTATTAAGTAGCCCGCGGCGCGGAGTCTCTTTCCACTTGGCTAAGGCGAACCGCCCCAGACGCGTCCGCGCGCCGGCAGCTGCAGGCTCAGGCCATCTCCAGTCTTCCTGCCGCGCCCGCCTCTCCTCCTGGGATTCTCCTCCTCCTCCTGGACTTCCCCGCAGCTGCCCACGCCTCGGCGGCCGCCAGGTGCTCCTGGAGTGCAGCGCCTATCGCCGGGGCGTGTGGGGGCCACACCGAGCACCAGCTTCTCCGACGCCGGGAAGCCGCTGTCGCCGCCGCTACCTCTCCCTGTTGCCGCCGCCTCAGATCTCTTCATGCCGCTGTAAGCTCGGAGGCCAAGGATGCGGAGTAGGCTTCCCCCAGCGCTTGCCGCCCTGGGCGCGGCCCTGCTCCTGTCTTCCATTGAGGCAGAAGTTGACCCACCTTCAGACTTGAATTTTAAAATTATAGATGAAAATACTGTTCATATGTCATGGGCAAAACCAGTTGATCCAATTGTGGGTTACAGAATAACGGTGGACCCTACAACGGATGGGCCTACTAAAGAATTTACCCTTTCAGCTAGTACCACTGAAACTTTATTGTCAGAACTTGTACCTGAAACAGAGTATGTGGTGACAATAACTTCATATGATGAAGTAGAAGAAAGTGTACCAGTTATAGGACAACTAACAATTCAAACAGGTAGTTCGACAAAGCCAGTGGAGAAGAAACCTGGAAAAACCGAGATACAAAAATGCTCTGTCAGTGCCTGGACTGATTTGGTTTTCCTCGTGGATGGCTCTTGGAGTGTGGGAAGAAATAATTTCAAGTACATTTTAGACTTCATTGCTGCTCTTGTGTCTGCTTTTGACATTGGGGAAGAGAAGACAAGAGTTGGAGTTGTTCAATACAGCTCTGATACCAGGACTGAATTTAACTTAAATCAGTACTACCAAAGGGATGAACTTCTTGCTGCAATAAAAAAAATTCCATATAAAGGTGGCAACACAATGACAGGGGATGCCATTGATTATTTAGTTAAAAATACTTTCACGGAATCTGCTGGGGCAAGAGTTGGCTTTCCTAAAGTGGCAATTATTATTACGGATGGAAAATCCCAGGATGAAGTGGAAATTCCAGCAAGAGAGCTTCGTAATGTTGGAGTTGAAGTTTTCTCCTTGGGCATTAAAGCTGCAGATGCAAAAGAACTCAAACAAATTGCCTCCACACCTTCACTGAACCATGTTTTCAATGTGGCCAACTTTGATGCAATTGTGGATATTCAGAATGAGATCATCTCCCAGGTGTGCTCAGGTGTTGATGAACAACTTGGTGAATTGGTTAGTGGAGAAGAAGTTGTTGAGCCTCCTTCAAATTTGATTGCCATGGAAGTCTCTTCAAAATATGTTAAGCTAAATTGGAATCCATCTCCTAGTCCAGTGACTGGCTACAAAGTCATCCTCACACCAATGACTGCAGGAAGCCGACAGCACGCTCTGAGTGTGGGGCCTCAGACAACCACGCTCAGTGTTCGCGACCTCTCAGCAGACACAGAATACCAGATCAGTGTTTCCGCCATGAAGGGAATGACATCCAGTGAACCCATTTCAATAATGGAGAAGACTCAGCCAATGAAAGTTCAAGTGGAATGCTCACGTGGTGTGGATATAAAAGCCGATATTGTGTTTTTGGTTGATGGCTCCTATAGCATTGGGATTGCAAACTTTGTTAAAGTTAGAGCCTTTTTGGAAGTTCTTGTAAAAAGTTTTGAAATTTCACCAAATAGGGTCCAGATTAGTCTTGTGCAATACAGCCGGGATCCTCATACTGAGTTCACTTTGAAAAAATTCACCAAAGTTGAAGATATAATTGAAGCAATAAACACCTTCCCTTACAGAGGAGGATCTACAAATACTGGCAAAGCAATGACTTATGTCAGAGAGAAAATATTTGTGCCTAGCAAGGGATCAAGAAGCAATGTGCCAAAGGTCATGATTCTTATCACGGATGGGAAATCATCAGATGCTTTCAGAGATCCTGCGATAAAACTGAGGAATTCAGATGTTGAAATCTTTGCAGTTGGTGTGAAGGATGCCGTTCGCTCAGAATTGGAAGCTATTGCCTCTCCTCCTGCAGAGACCCATGTGTTCACAGTGGAAGATTTTGATGCTTTTCAGAGGATATCTTTTGAACTCACACAGTCTATCTGCCTTAGAATTGAGCAAGAATTGGCAGCTATAAAGAAGAAAGCTTACGTCCCTCCAAAGGATCTTAGTTTTTCAGAAGTGACTTCTTATGGTTTCAAAACCAACTGGTCTCCAGCTGGAGAAAATGTTTTTTCATATCACATCACCTACAAGGAAGCGGCTGGGGATGATGAGGTCACTGTGGTGGAGCCAGCATCGAGCACCAGTGTTGTTCTCAGCAGCCTGAAGCCAGAGACCTTGTATTTGGTCAATGTGACTGCGGAGTATGAGGATGGCTTCAGCATTCCCTTAGCTGGAGAGGAGACCACCGAAGAAGTAAAAGGAGCACCTCGAAACCTAAAGGTGACAGATGAGACTACAGATAGTTTCAAAATTACTTGGACTCAAGCTCCAGGGAGAGTTTTAAGATATCGAATTATATATAGACCAGTTGCTGGTGGAGAGAGCAGAGAAGTTACCACCCCACCCAATCAGAGGAGGAGAACACTGGAGAACTTGATTCCAGACACGAAATATGAAGTATCTGTAATTCCTGAATATTTCTCAGGACCTGGTACTCCATTAACTGGAAATGCAGCCACTGAAGAAGTTAGAGGGAATCCAAGAGACTTAAGAGTTTCTGACCCTACGACGTCTACTATGAAATTATCTTGGAGTGGGGCACCAGGAAAAGTGAAACAGTATCTCGTCACATATACCCCAGTGGCAGGGGGTGAAACTCAAGAGGTCACTGTGAGGGGAGATACAACCAATACGGTGCTGCAGGGATTGAAGGAAGGGACACAATACGCCTTATCTGTGACAGCCTTGTATGCGTCTGGGGCTGGAGACGCCCTCTTTGGTGAAGGAACAACACTTGAAGAACGTGGTTCTCCTCAAGATTTAGTTACTAAAGACATCACTGACACATCAATTGGGGCTTATTGGACATCTGCTCCAGGAATGGTTCGCGGTTACAGGGTCTCATGGAAATCACTTTATGATGATGTTGACACTGGAGAGAAAAATCTGCCTGAAGATGCAATTCATACGATGATAGAAAATCTGCAGCCAGAGACCAAATACAGAATTTCAGTATTTGCCACTTACAGCAGTGGAGAAGGAGAACCTTTGACTGGAGATGCCACAACTGAATTATCTCAAGATTCCAAAACCCTGAAAGTAGATGAAGAAACAGAAAACACAATGAGAGTTACATGGAAACCAGCACCAGGGAAAGTCGTCAACTACCGTGTTGTCTATCGCCCTCATGGGAGAGGGAAGCAAATGGTTGCTAAGGTGCCCCCCACAGTCACTTCGACAGTGTTAAAGCGACTTCAGCCACAGACCACATATGACATCACAGTTCTTCCTATTTACAAGATGGGAGAAGGAAAGCTTAGGCAAGGATCAGGAACAACAGCTTCTCGGTTTAAGTCTCCTAGAAACCTCAAAACATCTGACCCAACCATGTCAAGCTTCCGAGTGACTTGGGAGCCTGCCCCTGGGGAAGTGAAGGGTTATAAAGTCACATTCCACCCTACGGGGGATGACAGAAGACTGGGGGAGTTAGTGGTTGGACCCTATGACAACACAGTTGTTTTGGAGGAACTTAGGGCTGGTACCACCTATAAAGTAAATGTTTTTGGAATGTTTGATGGAGGAGAAAGCTCACCACTTGTTGGACAAGAAATGACAACCCTTTCCGACACAACTGTTATGCCAATTTTATCTTCTGGGATGGAGTGTCTCACCAGAGCTGAGGCAGACATTGTGTTGCTGGTGGATGGATCATGGAGCATCGGCCGGGCAAATTTTAGAACCGTGAGGAGTTTCATTTCTCGTATTGTGGAAGTCTTTGACATTGGCCCCAAAAGAGTACAAATTGCTCTTGCTCAGTATAGTGGGGATCCCAGAACAGAGTGGCAGTTAAATGCACACAGAGACAAGAAGAGCTTGTTGCAAGCTGTGGCAAACTTGCCGTACAAAGGAGGCAATACTCTCACAGGCATGGCTTTGAATTTCATTCGCCAACAGAACTTCAGGACCCAAGCTGGCATGAGACCTCGAGCTCGAAAAATTGGTGTGCTCATTACTGATGGAAAATCACAAGACGATGTTGAAGCACCTTCAAAGAAACTCAAGGATGAGGGAGTGGAGCTGTTTGCTATTGGTATTAAAAATGCTGATGAAGTCGAATTAAAGATGATTGCAACTGATCCTGATGATACCCATGCATACAATGTGGCAGATTTTGAGTCACTCTCCAGGATAGTGGATGATCTCACCATTAATTTGTGTAACAGTGTCAAAGGTCCAGGTGATTTGGAAGCACCTTCTAACTTAGTTATTTCTGAGCGAACCCATCGTTCTTTTAGAGTGAGCTGGACACCACCTTCTGACAGTGTGGATCGATATAAGGTGGAATACTATCCAGTTTCTGGAGGGAAACGTCAAGAATTTTATGTGAGTCGAATGGAAACTAGCACAGTGCTGAAAGATCTGAAACCTGAAACTGAATATGTTGTCAATGTGTATTCTGTGGTAGAAGATGAATATAGTGAGCCTCTGAAGGGGACAGAAAAAACCTTGCCAGTGCCTGTAGTCAGCCTGAATATTTATGATGTTGGCCCTACCACCATGCATGTGCAGTGGCAGCCTGTGGGAGGAGCTACTGGCTACATCTTGTCATACAAACCTGTTAAGGACACAGAGCCAACAAGACCCAAAGAGGTGCGTTTGGGGCCAACAGTGAATGACATGCAGCTGACTGACCTTGTTCCCAACACGGAGTATGCAGTCACAGTCCAGGCTGTCCTGCACGACCTCACTAGTGAACCTGTCACTGTTCGGGAAGTCACCTTGCCTTTACCCAGACCTCAGGATCTGAAACTCAGAGATGTGACTCACAGCACTATGAATGTCTTTTGGGAACCTGTGCCTGGAAAAGTGCGTAAATATATTGTTCGATACAAAACACCAGAAGAGGATGTCAAAGAGGTAGAGGTGGACAGATCAGAGACCAGCACTTCCCTCAAAGACCTCTTCTCACAGACCTTGTACACAGTCAGCGTTTCTGCAGTACATGACGAGGGGGAGTCTCCTCCAGTGACTGCTCAAGAAACTACCCGACCCGTGCCAGCCCCAACAAACTTAAAGATTACTGAAGTAACATCAGAGGGTTTCAGAGGGACTTGGGATCATGGAGCTTCAGATGTGTCTCTCTACAGAATAACTTGGGCACCTTTTGGAAGCTCAGATAAGATGGAGACCATCTTAAATGGAGATGAAAACACTTTGGTGTTCGAAAACCTGAACCCCAACACCATCTATGAAGTTTCCATTACTGCCATCTATCCTGATGAGTCAGAAAGTGATGACCTGATTGGCAGTGAGCGCACACTGCCTATCTTAACAACACAAGCTCCCAAAAGTGGCCCACGAAACCTTCAAGTGTACAATGCAACATCTAACAGCCTGACTGTTAAGTGGGATCCTGCTAGTGGTCGTGTGCAGAAATATAGGATCACTTATCAGCCTTCCACAGGGGAAGGCAATGAGCAAACGACCACAATAGGAGGACGGCAGAACAGTGTGGTCCTGCAGAAACTGAAGCCAGACACTCCTTACACTATCACCGTATCCTCTCTGTATCCTGATGGTGAAGGAGGTCGGATGACGGGAAGAGGCAAGACCAAACCTCTAAACACTGTAAGGAACCTGAGAGTGTATGACCCTTCTACCAGCACCTTGAATGTCCGCTGGGACCATGCAGAGGGAAATCCTCGTCAGTACAAGCTCTTCTATGCACCAGCAGCAGGTGGTCCAGAGGAACTGGTACCAATCCCCGGGAATACCAATTATGCCATTCTTAGGAATCTGCAGCCAGATACCTCATACACTGTGACTGTAGTTCCCGTTTATACTGAAGGTGATGGGGGACGCACATCAGATACTGGAAGGACATTGATGAGAGGACTGGCAAGAAATGTCCAAGTATACAATCCTACACCTAACAGCCTCGATGTTCGCTGGGACCCTGCTCCAGGACCTGTGCTGCAATATCGCGTTGTGTATTCTCCTGTGGATGGCACAAGACCCTCAGAATCTATAGTAGTGCCAGGAAACACGCGCATGGTGCATCTGGAGCGGCTGATTCCGGACACACTCTATTCCGTGAACCTTGTGGCTCTGTACTCGGATGGAGAGGGAAATCCCAGCCCTGCCCAGGGCCGAACGCTACCACGCAGTGGACCAAGGAACCTGAGAGTCTTTGGTGAAACAACCAATAGCCTCTCGGTAGCCTGGGATCATGCTGATGGGCCAGTTCAGCAGTACAGGATCATCTATTCTCCCACTGTTGGTGATCCAATTGATGAATATACCACAGTCCCAGGCAGAAGAAACAATGTAATACTGCAGCCCCTGCAACCTGACACTCCATATAAAATTACTGTTATTGCTGTTTATGAAGATGGAGATGGTGGCCATCTAACAGGAAATGGAAGAACTGTGGGACTCCTTCCTCCTCAGAACATACACATCTCTGACGAATGGTATACAAGATTCAGGGTGTCCTGGGATCCTTCACCTTCTCCAGTTCTTGGATATAAAATAGTATATAAGCCAGTGGGTTCCAATGAGCCCATGGAAGCCTTTGTTGGAGAAATGACATCATATACCTTACACAATCTCAATCCCAGCACCACCTACGATGTGAATGTTTATGCTCAATATGATTCTGGACTCAGTGTCCCCTTGACAGATCAAGGCACTACATTATATTTAAATGTAACAGATCTGAAAACTTACCAGATTGGGTGGGATACATTCTGTGTCAAATGGTCACCTCACCGGGCAGCCACCTCCTACAGGCTAAAACTAAGCCCTGCAGATGGAACAAGGGGACAAGAAATTACAGTGCGTGGATCAGAAACCAGTCACTGCTTCACTGGCCTTTCACCAGACACTGATTATGGTGTCACTGTTTTTGTGCAGACACCAAATCTCGAGGGACCAGGAGTCTCTGTTAAAGAACATACCACTGTGAAACCAACAGAAGCCCCTACAGAGCCACCCACACCTCCTCCCCCTCCCACCATTCCACCAGCCCGGGATGTATGCAAAGGGGCCAAGGCAGATATTGTGTTCTTGACTGATGCCTCCTGGAGCATTGGGGACGATAATTTTAACAAAGTTGTAAAATTCATCTTCAATACTGTGGGAGGCTTTGATGAAATCAGTCCTGCTGGGATTCAGGTTTCATTTGTGCAATACAGCGATGAGGTCAAGTCTGAGTTCAAGCTGAACACGTACAATGACAAGGCCCTAGCCCTTGGGGCCCTCCAGAATATTAGGTACAGAGGAGGAAACACAAGAACAGGCAAGGCCCTCACGTTTATCAAGGAGAAAGTCTTGACTTGGGAGAGCGGCATGAGGAAGAATGTCCCTAAGGTGTTGGTTGTGGTCACGGACGGTCGGTCCCAGGATGAGGTCAAGAAGGCGGCTTTGGTCATCCAGCAGTCAGGGTTCAGTGTCTTTGTAGTTGGTGTGGCTGATGTCGACTACAATGAGCTTGCCAACATTGCCAGCAAACCAAGTGAACGGCACGTGTTCATTGTGGACGACTTTGAATCTTTTGAGAAGATCGAAGACAATCTTATTACATTTGTTTGTGAAACTGCCACTTCAAGTTGTCCTCTCATTTATTTGGATGGCTACACCTCACCAGGTTTTAAAATGCTTGAAGCATACAACCTGACAGAAAAGAATTTTGCTTCTGTACAAGGAGTATCTTTGGAGTCAGGGTCTTTCCCCAGCTACTCAGCATACAGGATTCAGAAGAATGCGTTTGTGAATCAGCCTACAGCAGACCTACACCCAAATGGACTCCCTCCTTCATACACGATTATATTATTATTCAGACTTCTCCCAGAAACTCCCAGTGACCCTTTTGCAATTTGGCAAATCACAGACAGAGACTACAAACCACAAGTTGGAGTGATTGCAGATCCTTCTAGCAAGACGTTATCATTCTTTAACAAGGATACAAGAGGCGAGGTGCAAACTGTTACATTTGACACAGAAGAAGTAAAGACATTATTTTATGGAAGTTTTCACAAGGTTCATATTGTAGTGACCTCAAAAAGTGTTAAGATTTACATTGACTGCTATGAAATTATAGAAAAAGACATCAAGGAAGCTGGAAATATAACAACTGATGGTTATGAAATTCTTGGAAAACTCCTTAAAGGGGAAAGGAAATCAGCCGCATTCCAAATCCAGAGTTTTGACATTGTCTGCAGTCCAGTGTGGACCAGTAGAGACAGATGCTGTGATATTCCCTCTAGGAGAGATGAGGGAAAATGCCCTGCTTTTCCAAATTCTTGCACATGTACACAGGACAGCGTTGGACCTCCAGGACCTCCAGGCCCTGCAGGAGGACCTGGTGCTAAAGGTCCCAGAGGTGAAAGAGGTATCAGTGGGGCAATTGGGCCCCCTGGTCCTCGTGGAGACATAGGTCCTCCAGGCCCCCAGGGTCCTCCAGGCCCTCAGGGACCCAATGGACTCTCTATTCCGGGAGAGCAAGGTCGCCAAGGGATGAAAGGTGATGCTGGAGAGCCAGGACTTCCAGGCCGAACAGGAACCCCAGGATTACCTGGCCCACCAGGACCAATGGGACCTCCAGGAGACAGAGGCTTCACTGGAAAAGACGGTGCAATGGGACCCAGGGGCCCACCAGGGCCGCCGGGAAGCCCAGGCTCCCCAGGAGTCACAGGACCAAGTGGGAAGCCAGGAAAACCTGGAGATCATGGCAGACCAGGTCCATCTGGGTTGAAAGGAGAAAAAGGTGATAGGGGAGACATTGCTTCCCAGAACATGATGCGAGCAGTTGCAAGACAAGTCTGTGAACAATTGATAAGTGGTCAGATGAACAGATTCAATCAGATGCTGAATCAGATTCCAAATGATTACCAGTCCAGTCGCAACCAGCCAGGCCCGCCGGGTCCACCGGGACCTCCTGGTAGCGCAGGAGCCAGAGGAGAACCTGGGCCTGGGGGGCGGCCAGGCTTCCCGGGCACACCAGGGATGCAGGGACCCCCTGGGGAACGAGGTTTGCCAGGAGAGAAAGGTGAAAGGGGTACTGGATCTTCAGGACCTCGGGGGCTGCCTGGCCCCCCAGGTCCACAAGGAGAATCCAGAACAGGTCCACCAGGGTCCACAGGTTCAAGAGGTCCCCCTGGCCCCCCTGGCCGTCCTGGAAACTCAGGTATCCGAGGACCCCCAGGTCCTCCTGGATACTGTGATTCTTCTCAGTGTGCCAGCATCCCATACAACGGGCAAGGCTATCCAGAGCCTTACGTGCCCGAGGGCGGGGCCTACCTGCCTGAGCGCGAGCCCTTCATCGTGCCGGTGGAGCCCGAGCGGACAGCGGAATACGAGGACTACGGCGCAGACGAGCCTGCAGAGGAGCCTCCTGAGCCCCACCGGCGCTGGCGGCGCGCCCTGCCCCACGGACCCGGGCAGTGAACCAGAGATCACGCGCCGCGCCGCGAGGCTTGGGGGAGGTGTTGAAATTCTCATTTACAGGTCAGATAGAGCAGTGTACGTCTTTTCTGAGGTGTTTCTTCCAGCGTTGCTCATCCAGGAGTACCCTTTCTGATTGTAGAGAACCTTGTTTCTGCAGGAAGCCTAGCTCCAAGCACGCAGTCTGTAGACATTTTTGCCTTTGCCCTTGAAATGCTTGCAAAATACTTTGTTAACAAAAGCTGCAAAGAGAGAACATGCCGTGTGCCTTTAGTTAGCACAGCGGGCAGCCTCAGTGAAACTCTTAGGTTAAGCAGTTAAGTCCTGGAACCCAGAGCTGCTGTGTATTTCGAGCGGGCAGTTTATCTTTTGCTATACTTATTTTCAATTCAATTACACCACGATTCAAATAATTCCCCTCCTAAAACCAAAAAGGAGGGAAACGTCAACTCCATTGCAATTACTTATCTTCCTCTTCTATCTCTGTTATACGCCGGGGCATAGAATGCTCGTATACATCTCTTTAACAACCACAAACCTTAAGCCATGTAGATGAAGTTAGTGCATCAACGGGATACAGTTCCATATTGCCTTAAACCTCCTTGTTTTAGACACACTAACATTTATACCAAATTGCAGATTATTCTGCAGAGAGGGAATTGCATGTTTGTGTTGTATATTTAGTATGAACTTTTTTCAGAATATAATATTTCTTAGTTATCAAAAGTAGTTGGAAAACATTTGCAAGACTATGAACATAGAATTGCTGCTTTTATATTTTAACTGCAGATTGTGAATTTCACTGCCTTATATTATTTATTTCTGAAACAAAAGAGGCATTTTTCAATAAAACTACTGAAAATTTGACA