Transcript asmbl_120771

Sequence
Transcript Sequence for observation asmbl_120771 of TGE0058076:
CGCCACCTCACGCCGAAGGAATGCTCGAAGTATGCACACGTTCCCAAAAGTAGACCTCCTTCACCGCCGGAGGAGCATACATCACCCCGTGGCAGCCGTCCACCTTCTCAGGCGTTTCGTAACCGAGTAAACTGAGAGCTGGGAACAGCCCTCTATTAAGTAGCCCGCGGCGCGGAGTCTCTTTCCACTTGGCTAAGGCGAACCGCCCCAGACGCGTCCGCGCGCCGGCAGCTGCAGGCTCAGGCCATCTCCAGTCTTCCTGCCGCGCCCGCCTCTCCTCCTGGGATTCTCCTCCTCCTCCTGGACTTCCCCGCAGCTGCCCACGCCTCGGCGGCCGCCAGGTGCTCCTGGAGTGCAGCGCCTATCGCCGGGGCGTGTGGGGGCCACACCGAGCACCAGCTTCTCCGACGCCGGGAAGCCGCTGTCGCCGCCGCTACCTCTCCCTGTTGCCGCCGCCTCAGATCTCTTCATGCCGCTGTAAGCTCGGAGGCCAAGGATGCGGAGTAGGCTTCCCCCAGCGCTTGCCGCCCTGGGCGCGGCCCTGCTCCTGTCTTCCATTGAGGCAGAAGTTGACCCACCTTCAGACTTGAATTTTAAAATTATAGATGAAAATACTGTTCATATGTCATGGGCAAAACCAGTTGATCCAATTGTGGGTTACAGAATAACGGTGGACCCTACAACGGATGGGCCTACTAAAGAATTTACCCTTTCAGCTAGTACCACTGAAACTTTATTGTCAGAACTTGTACCTGAAACAGAGTATGTGGTGACAATAACTTCATATGATGAAGTAGAAGAAAGTGTACCAGTTATAGGACAACTAACAATTCAAACAGGTAGTTCGACAAAGCCAGTGGAGAAGAAACCTGGAAAAACCGAGATACAAAAATGCTCTGTCAGTGCCTGGACTGATTTGGTTTTCCTCGTGGATGGCTCTTGGAGTGTGGGAAGAAATAATTTCAAGTACATTTTAGACTTCATTGCTGCTCTTGTGTCTGCTTTTGACATTGGGGAAGAGAAGACAAGAGTTGGAGTTGTTCAATACAGCTCTGATACCAGGACTGAATTTAACTTAAATCAGTACTACCAAAGGGATGAACTTCTTGCTGCAATAAAAAAAATTCCATATAAAGGTGGCAACACAATGACAGGGGATGCCATTGATTATTTAGTTAAAAATACTTTCACGGAATCTGCTGGGGCAAGAGTTGGCTTTCCTAAAGTGGCAATTATTATTACGGATGGAAAATCCCAGGATGAAGTGGAAATTCCAGCAAGAGAGCTTCGTAATGTTGGAGTTGAAGTTTTCTCCTTGGGCATTAAAGCTGCAGATGCAAAAGAACTCAAACAAATTGCCTCCACACCTTCACTGAACCATGTTTTCAATGTGGCCAACTTTGATGCAATTGTGGATATTCAGAATGAGATCATCTCCCAGGTGTGCTCAGGTGTTGATGAACAACTTGGTGAATTGGTTAGTGGAGAAGAAGTTGTTGAGCCTCCTTCAAATTTGATTGCCATGGAAGTCTCTTCAAAATATGTTAAGCTAAATTGGAATCCATCTCCTAGTCCAGTGACTGGCTACAAAGTCATCCTCACACCAATGACTGCAGGAAGCCGACAGCACGCTCTGAGTGTGGGGCCTCAGACAACCACGCTCAGTGTTCGCGACCTCTCAGCAGACACAGAATACCAGATCAGTGTTTCCGCCATGAAGGGAATGACATCCAGTGAACCCATTTCAATAATGGAGAAGACTCAGCCAATGAAAGTTCAAGTGGAATGCTCACGTGGTGTGGATATAAAAGCCGATATTGTGTTTTTGGTTGATGGCTCCTATAGCATTGGGATTGCAAACTTTGTTAAAGTTAGAGCCTTTTTGGAAGTTCTTGTAAAAAGTTTTGAAATTTCACCAAATAGGGTCCAGATTAGTCTTGTGCAATACAGCCGGGATCCTCATACTGAGTTCACTTTGAAAAAATTCACCAAAGTTGAAGATATAATTGAAGCAATAAACACCTTCCCTTACAGAGGAGGATCTACAAATACTGGCAAAGCAATGACTTATGTCAGAGAGAAAATATTTGTGCCTAGCAAGGGATCAAGAAGCAATGTGCCAAAGGTCATGATTCTTATCACGGATGGGAAATCATCAGATGCTTTCAGAGATCCTGCGATAAAACTGAGGAATTCAGATGTTGAAATCTTTGCAGTTGGTGTGAAGGATGCCGTTCGCTCAGAATTGGAAGCTATTGCCTCTCCTCCTGCAGAGACCCATGTGTTCACAGTGGAAGATTTTGATGCTTTTCAGAGGATATCTTTTGAACTCACACAGTCTATCTGCCTTAGAATTGAGCAAGAATTGGCAGCTATAAAGAAGAAAGCTTACGTCCCTCCAAAGGATCTTAGTTTTTCAGAAGTGACTTCTTATGGTTTCAAAACCAACTGGTCTCCAGCTGGAGAAAATGTTTTTTCATATCACATCACCTACAAGGAAGCGGCTGGGGATGATGAGGTCACTGTGGTGGAGCCAGCATCGAGCACCAGTGTTGTTCTCAGCAGCCTGAAGCCAGAGACCTTGTATTTGGTCAATGTGACTGCGGAGTATGAGGATGGCTTCAGCATTCCCTTAGCTGGAGAGGAGACCACCGAAGAAGTAAAAGGAGCACCTCGAAACCTAAAGGTGACAGATGAGACTACAGATAGTTTCAAAATTACTTGGACTCAAGCTCCAGGGAGAGTTTTAAGATATCGAATTATATATAGACCAGTTGCTGGTGGAGAGAGCAGAGAAGTTACCACCCCACCCAATCAGAGGAGGAGAACACTGGAGAACTTGATTCCAGACACGAAATATGAAGTATCTGTAATTCCTGAATATTTCTCAGGACCTGGTACTCCATTAACTGGAAATGCAGCCACTGAAGAAGGTAGAGGAAATATGCTTATCATATGGTGACAACCAAACTCTTAGACTAGAGGGGAAAATTGGGACAACTATCCAGATAAAAAACTAATGAGACACTTTGTTTCAATTGTTTGAGTATGTTAGACCATAGTCCTTTTAGATTTAAGTTAAAATTTTTTTTTTACTTAATCATGACATTATTTACTTGTGTCAATAGATTTATTTGTTTAATTAATTATTTAATTAATTTTTTTCAGACAGAGTCTCTCTCTGTTGCCC