Transcript asmbl_120435

Sequence
Transcript Sequence for observation asmbl_120435 of TGE0002344:
AACTAACCTCTGACGTCACCCTAATAACCACCAATCAGATACAGGACTTTCACTCTTCACCTTATTTGCATGAGAGGTCCTATATAAAAACGACTCCTGGTACCTTGCTCCCATTACTTCCCGTTTTCTCGATCTGCTGCTCGTCTCAGGCTCGTAGTTCGCCTTCAACATGCCGGAACCAGCGAAGTCCGCTCCCGCGCCCAAGAAGGGCTCGAAGAAAGCCGTGACTAAGGCGCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTATACGTGTACAAGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCCTCTAAGGCCATGGGAATCATGAACTCCTTCGTCAACGACATCTTCGAACGCATCGCGGGTGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGTTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCCGTCACCAAGTACACCAGCGCTAAGTAAACTTGCCAAGGAGGGACTTTCTCTGGAATTTCCTGATATGACCAAGAAAGCTTCTTATCAAAAGAAGCACAATTGCCTTCGGTTACCTCATTATCTACTGCAGAAAAGAAGACGAGAATGCAACCATACCTAGATGGACTTTTCCACAAGCTAAAGCTGGCCTCTTGATCTCATTCAGATTCCAAAGAGAATCATTTACAAGTTAATTTCTGTCTCCTTGGTCCATTCCTTCTCTCTAATAATCATTTACTGTTCCTCAAAGAATTGTCTACATTACCCATCTCCTCTTTTGCCTCTGAGAAAGAGTATATAAGCTTCTGTACCCCACTGGGGGGTTGGGGTAATATTCTGTGGTCCTCAGCCCTGTACCTTAATAAATTTGTATGCCTTTTCTCTTATTAATCTTGTCAGTTGATTTTCAGTGAACTTTCAGAGGCCAAAAGGGAGGTTTTCTCTTGGCCCCTGCACCAGTAGCAGTTCCTGATATGCCTACAACCTTAACTAATGCTGGGTAGAACCATTTAAAGTAATCTAACTTTACTAATAA