Transcript asmbl_119543

Sequence
Transcript Sequence for observation asmbl_119543 of TGE0002270:
GCTCCGTGCAGCCTGAGAGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGTCACCCTCGTCTTGCATTTTCCCGCGTGCGTGTGTGAGTGGGTGTGTGTGTTTTCTTACAAAGGGTATTTCGCGATCGATCGATTGATTCGTAGTTCCCCCCCGCGCGCCTTTGCCCTTTGTGCTGTAATCGAGCTCCCGCCATCCCAGGTGCTTCTCCGTTCCTCTAAACGCCAGCGTCTGGACGTGAGCGCAGGTCGCCGGTTTGTGCCTTCGGTCCCCGCTTCGCCCCCTGCCGTCCCCTCCTTATCACGGTCCCGCTCGCGGCCTCGCCGCCCCGCTGTCTCCGCCGCCCGCCATGGCGACTGCGACCCCCGTGCCGCCGCGGATGGGCAGCCGCGCTGGCGGCCCCACCACGCCGCTGAGCCCCACGCGCCTGTCGCGGCTCCAGGAGAAGGAGGAGCTGCGCGAGCTCAATGACCGGCTGGCGGTGTACATCGACAAGGTGCGCAGCCTGGAGACGGAGAACAGCGCGCTGCAGCTGCAGGTGACGGAGCGCGAGGAGGTGCGCGGCCGTGAGCTCACCGGCCTCAAGGCGCTCTACGAGACCGAGCTGGCCGACGCGCGACGCGCGCTCGACGACACGGCCCGCGAGCGCGCCAAGCTGCAGATCGAGCTGGGCAAGTGCAAGGCGGAACACGACCAGCTGCTCCTCAACTATGCTAAGAAGGAATCTGATCTTAATGGCGCCCAGATCAAGCTTCGAGAATATGAAGCAGCACTGAATTCGAAAGATGCAGCTCTTGCTACTGCACTTGGTGACAAAAAAAGTTTAGAGGGAGATTTGGAGGATCTGAAGGATCAGATTGCCCAGTTGGAAGCCTCCTTAGCTGCAGCCAAAAAACAGTTAGCAGATGAAACTTTACTTAAAGTAGATTTGGAGAATCGTTGTCAGAGCCTTACTGAGGACTTGGAGTTTCGCAAAAGCATGTATGAAGAGGAGATTAACGAGACCAGAAGGAAGCATGAAACGCGCTTGGTAGAGGTGGATTCTGGGCGTCAAATTGAGTATGAGTACAAGCTGGCGCAAGCCCTTCATGAGATGAGAGAGCAACATGATGCCCAAGTGAGGCTGTATAAGGAGGAGCTGGAGCAGACTTACCATGCCAAACTTGAGAATGCCAGACTGTCATCAGAGATGAATACTTCTACTGTCAACAGTGCCAGGGAAGAACTGATGGAAAGCCGCATGAGAATTGAGAGCCTTTCATCCCAGCTTTCTAATCTACAGAAAGAGTCTAGAGCATGTTTGGAAAGGATTCAAGAATTAGAGGACTTGCTTGCTAAAGAAAAAGACAACTCTCGTCGCATGCTGACAGACAAAGAGAGAGAGATGGCGGAAATAAGGGATCAAATGCAGCAACAGCTGAATGACTATGAACAGCTTCTTGATGTAAAGTTAGCCCTGGACATGGAAATCAGTGCTTACAGGAAACTCTTAGAAGGCGAAGAAGAGAGGTTGAAGCTGTCTCCAAGCCCTTCTTCCCGTGTGACAGTATCCCGAGCATCCTCAAGTCGTAGTGTACGTACAACTAGAGGAAAGCGGAAGAGGGTTGATGTGGAAGAATCAGAGGCGAGTAGTAGTGTTAGCATCTCTCATTCCGCCTCAGCCACTGGAAATGTTTGCATCGAAGAAATTGATGTTGATGGGAAATTTATCCGCTTGAAGAACACTTCTGAACAGGATCAACCAATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGTTATAAATATACCTCAAGATATGTGCTGAAGGCAGGCCAGACTGTTACAATTTGGGCTGCAAACGCTGGTGTCACAGCCAGCCCCCCAACTGACCTCATCTGGAAGAACCAGAACTCGTGGGGCACTGGCGAAGATGTGAAGGTTATATTGAAAAATTCTCAGGGAGAGGAGGTTGCTCAAAGAAGTACAGTCTTTAAAACAACCATACCTGAAGAAGAGGAGGAGGAGGAAGAAGCAGCTGGAGTGGTTGTTGAGGAAGAACTTTTCCACCAGCAGGGAACCCCAAGAGCATCCAATAGAAGCTGTGCAATTATGTAAAATTTTCAACTGTCTTCCTCAAAATAAAGAAGTATGGTAATCTTTACCTGTATACAGTGCAGAGCCTTCTCAGAAGCACAGAATATTTTTATATTTCCTTTATGTGAATTTTTAAGCTGCAAATCTGATGGCCTTAATTTCCTTTTTGACACTGAAAGTTTTGTAAAAGAAATCATGTCCATACACTTTGTTGCAAGATGTGAATTATTGACACTGAACTTAATAACTGTGTACTGTTCGGAAGGGGTTCCTCAAATTTTTTGACTTTTTTTGTATGTGTGTTTTTTCTTTTTTTTTAAGTTCTTATGAGGAGGGGAGGGTAAATAAACCACTGTGCGTCTTGGTGTAATTTGAAGATTGCCCCATCTAGACTAGCAATCTCTTCATTATTCTCTGCTATATATAAAACGGTGCTGTGAGGGAGGGGAAAAGCATTTTTCAATATATTGAACTTTTGTACTGAATTTTTTTGTAATAAGCAATCAAGGTTATAATTTTTTTTAAAATAGAAATTTTGTAAGAAGGCAATATTAACCTAATCACCATGTAAGCACTCTGGATGATGGATTCCACAAAACTTGGTTTTATGGTTACTTCTTCTCTTAGATTCTTAATTCATGAGGAGGGTGGGGG