Transcript asmbl_119414

Sequence
Transcript Sequence for observation asmbl_119414 of TGE0059544:
GGGGAGCGCTGCTGTCCCCAAGCCGATTGGTACTTCTTGTCAGGAAGAAACGCCAAGAGGTGGGAGTGCCTGGGGAGGGAGGCAGGCGGTCCCTACCGCAGGCGCGGGGAGCTGCCTTTCCGCCCCTCCGCCTGCTTTCCAAGCCTGGACTCTTAGGAGTGGCTGAAGCTGCGGAGCGCTTTTGGAGCCTGTGAATGAACCCTCCTCCTCTCCCTCCTCCTTCTTCTCGCTGAGTCTCCTCCTCGGCTCTGACGGTACAGTGATATAATGATGATGGGTGTCACAACCCGCATTTGAACTTGCAGGCGAGCTGCCCCGAGCCTTTCTGGGGAAGAACTCCAGGCGTGCGGACGCAACAGCCGAGAACATTAGGTGTTGTGGACAGGAGCTGGGACCAAGATCTTCGGCCAGCCCCGCATCCTCCCGCATCTTCCAGCACCGTCCCGCACCCTCCGCATCCTTCCCCGGGCCACCACGCTTCCTATGTGACCCGCCTGGGCAACGCCGAACCCAGTCGCGCAGCGCTGCAGTGAATTTTCCCCCCAAACTGCAATAAGCCGCCTTCCAAGGCCAAGATGTTCATAAATATAAAGAGCATCTTATGGATGTGTTCAACCTTAATAGTAACCCATGCGCTACATAAAGTCAAAGTGGGAAAAAGCCCACCGGTGAGGGGCTCCCTCTCTGGAAAAGTCAGCCTACCTTGTCATTTTTCAACGATGCCTACTTTGCCACCCAGTTACAACACCAGTGAATTTCTCCGCATCAAATGGTCTAAGATTGAAGTGGACAAAAATGGAAAAGATTTGAAAGAGACTACTGTCCTTGTGGCCCAAAATGGAAATATCAAGATTGGTCAGGACTACAAAGGGAGAGTGTCTGTGCCCACACATCCCGAGGCTGTGGGCGATGCCTCCCTCACTGTGGTCAAGCTGCTGGCAAGTGATGCGGGTCTTTACCGCTGTGACGTCATGTACGGGATTGAAGACACACAAGACACGGTGTCACTGACTGTGGATGGGGTTGTGTTTCACTACAGGGCGGCAACCAGCAGGTACACACTGAATTTTGAGGCTGCTCAGAAGGCTTGTTTGGACGTTGGGGCAGTCATAGCAACTCCAGAGCAGCTCTTTGCTGCCTATGAAGATGGATTTGAGCAGTGTGACGCAGGCTGGCTGGCTGATCAGACTGTCAGATATCCCATCCGGGCTCCCAGAGTAGGCTGTTATGGAGATAAGATGGGAAAGGCAGGAGTCAGGACTTATGGATTCCGTTCTCCCCAGGAAACTTACGATGTGTATTGTTATGTGGATCATCTGGATGGTGATGTGTTCCACCTCACTGTCCCCAGTAAATTCACCTTCGAGGAGGCTGCAAAAGAGTGTGAAAACCAGGATGCCAGGCTGGCAACAGTGGGGGAACTCCAGGCGGCATGGAGGAACGGCTTTGACCAGTGCGATTACGGGTGGCTGTCGGATGCCAGCGTGCGCCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGTGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACAGGCTTCCCTCCCCCTGATAGCAGATTTGATGCCTACTGCTTTAAACCTAAAGAGGCTACAACCATCGATTTGAGTATCCTCGCAGAAACTGCATCACCCAGTTTATCCAAAGAACCACAAATGGTTTCTGATAGAACTACACCAATCATCCCTTTAGTTGATGAATTACCTGTCATTCCAACAGAGTTCCCTCCCGTGGGAAATATTGTCAGTTTTGAACAGAAAGCCACAGTCCAACCTCAGGCTATCACAGATAGTTTAGCCACCAAATTACCCACACCTACTGGCAGTACCAAGAAGCCCTGGGATATGGATGACTACTCACCTTCTGCTTCAGGACCTCTTGGAAAGCTAGACATATCAGAAATTAAGGAAGAAGTGCTCCAGAGTACAACTGGCGTCTCTCATTATGCTACGGATTCATGGGATGGTGTCGTGGAAGATAAACAAACACAAGAATCGGTTACACAGATTGAACAAATAGAAGTGGGTCCTTTGGTAACATCTATGGAAATCTTAAAGCACATTCCTTCCAAGGAATTCCCTGTAACTGAAACACCATTGGTAACTGCAAGAATGATCCTGGAATCCAAAACTGAAAAGAAAATGGTAAGCACTGTTTCTGAATTGGTAACCACAGGTCACTATGGATTCACCTTGGGAGAAGAGGATGATGAAGACAGAACACTTACAGTTGGATCTGATGAGAGCACCTTGATCTTTGACCAAATTCCTGAAGTCATTACGGTGTCAAAGACTTCAGAAGACACCATCCACACTCATTTAGAAGACTTGGAGTCAGTCTCAGCATCCACAACTGTTTCCCCTTTAATTATGCCTGATAATAATGGATCATCCATGGATGACTGGGAAGAGAGACAAACTAGTGGTAGGATAACGGAAGAGTTTCTTGGCAAATATCTGTCTACTACACCTTTTCCATCACAGCATCGTACAGAAATAGAATTGTTTCCTTATTCTGGTGATAAAATATTAGTAGAGGGAATTTCCACAGTTATTTATCCTTCTCTACAAACAGAAATGACACATAGAAGAGAAAGAACAGAAACACTAATACCAGAGATGAGAACAGATACTTATACAGATGAAATACAAGAAGAGATCACTAAAAGTCCATTTATGGGAAAAACAGAAGAAGAAGTCTTCTCTGGGATGAAACTCTCTACATCTCTCTCAGAGCCAATTCATGTTACAGAGTCTTCTGTGGAAATGACCAAGTCTTTTGATTTCCCAACATTGATAACAAAGTTAAGTGCAGAGCCAACAGAAGTAAGAGATATGGAGGAAGACTTTACAGCAACTCCAGGTACTACAAAATATGATGAAAATATTACAACAGTGCTTTTGGCCCATGGTACTTTAAGTGTTGAAGCAGCCACTGTATCAAAATGGTCATGGGATGAAGATAATACAACATCCAAGCCTTTAGAGTCTACAGAACCTTCAGCCTCTTCAAAATTGCCCCCTGCCTTACTCACAACTGTGGGGATGAATGGAAAGGATAAAGACATCCCAAGTTTCACTGAAGATGGAGCAGATGAATTTACTCTTATTCCAGATAGTACTCAAAAGCAGTTAGAGGAGGTTACTGATGAAGACATAGCAGCCCATGGAAAATTCACAATTAGATTTCAGCCAACTACATCAACTGGTATTGCAGAAAAGTCAACTTTGAGAGATTCTACAACTGAAGAAAAAGTTCCACCTATCACAAGCACTGAAGGCCAAGTTTATGCAACCATGGAAGGAAGTGCTTTGGGTGAAGTAGAAGATGTGGACCTCTCTAAGCCAGTATCTACTGTTCCCCAATTTGCACACACTTCAGAGGTGGAAGGATTAGCATTTGTTAGTTATAGTAGCACCCAAGAGCCTACTACTTATGTAGACTCTTCCCATACCATTCCTCTTTCTGTAATTCCCAAGACAGACTGGGGAGTGTTAGTACCTTCTGTTCCATCAGAAGATGAAGTTCTAGGTGAACCCTCTCAAGACATACTTGTCATTGATCAGACTCGCCTTGAAGCGACTATTTCTCCAGAAACTATGAGAACAACAAAAATCACAGAGGGAACAACTCAGGAAGAATTCCCTTGGAAAGAACAGACTGCAGAGAAACCAGTTCCTGCTCTCAGTTCTACAGCTTGGACTCCCAAGGAGGCAGTAACACCACTGGATGAACAAGAGGGCGATGGATCAGCATATACAGTCTCTGAAGATGAATTGTTGACAGGTTCTGAGAGGGTCCCAGTTTTAGAAACAACTCCAGTTGGAAAAATTGATCACAGTGTGTCTTATCCACCAGGTGCTGTAACTGAGCACAAAGTGAAAACAGATGAAGTGGTAACACTAACACCACGCATTGGGCCAAAAGTATCTTTAAGTCCAGGGCCTGAACAAAAATATGAAACAGAAGGTAGTAGTACAACAGGATTTACATCATCTTTGAGTCCTTTTAGTACCCACATTACCCAGCTTATGGAAGAAACCACTACTGAGAAAACATCCCTAGAGGATATTGATTTAGGCTCAGGATTATTTGAAAAGCCCAAAGCCACAGAACTCATAGAATTTTCAACAATCAAAGTCACAGTTCCAAGTGATATTACCACTGCCTTCAGTTCAGTAGACAGACTTCACACAACTTCAGCATTCAAGCCATCTTCCGCGATCACTAAGAAACCACCTCTCATCGACAGGGAACCTGGTGAAGAAACAACCAGTGACATGGTAATCATTGGAGAATCAACATCTCATGTTCCTCCCACTACCCTTGAAGATATTGTAGCCAAGGAAACAGAAACCGATATTGATAGAGAGTATTTCACGACTTCAAGTCCTCCTGCTACACAGCCAACAAGACCACCCACTGTGGAAGACAAAGAGGCCTTTGGACCTCAGGCGCTTTCTACGCCACAGCCCCCAGCAAGCACAAAATTTCACCCTGACATTAATGTTTATATTATTGAGGTCAGAGAAAATAAGACAGGTCGAATGAGTGATTTGAGTGTAATTGGTCATCCAATAGATTCAGAATCTAAAGAAGATGAACCTTGTAGTGAAGAAACAGATCCAGTGCATGATCTAATGGCTGAAATTTTACCTGAATTCCCTGACATAATTGAAATAGACCTATACCACAGTGAAGAAAATGAAGAAGAAGAAGAAGAGTGTGCAAATGCTACTGATGTGACAACCACCCCATCTGTGCAGTACATAAATGGGAAGCATCTCGTTACCACTGTGCCCAAGGACCCAGAAGCTGCAGAAGCTAGGCGTGGCCAGTTTGAAAGTGTTGCACCTTCTCAGAATTTCTCGGACAGCTCTGAAAGTGATACTCATCCATTTGTAATAGCCAAAACGGAATTGTCTACTGCTGTGCAACCTAATGAATCTACAGAAACAACTGAGTCTCTTGAAGTTACATGGAAGCCTGAGACTTACCCTGAAACATCAGAACATTTTTCAGGTGGTGAGCCTGATGTTTTCCCCACAGTCCCATTCCATGAGGAATTTGAAAGTGGAACAGCCAAAAAAGGGGCAGAATCAGTCACAGAGAGAGATACTGAAGTTGGTCATCAGGCACATGAACATACTGAACCTGTATCTCTGTTTCCTGAAGAGTCTTCAGGAGAGATTGCCATTGACCAAGAATCTCAGAAAATAGCCTTTGCAAGGGCTACAGAAGTAACATTTGGTGAAGAGGTAGAAAAAAGTACTTCTGTCACATACACTCCCACTATAGTTCCAAGTTCTGCATCAGCATATGTTTCAGAGGAAGAAGCAGTTACCCTAATAGGAAATCCTTGGCCAGATGACCTGTTGTCTACCAAAGAAAGCTGGGTAGAAGCAACTCCTAGACAAGTTGTAGAGCTCTCAGGGAGTTCTTCGATTCCAATTACAGAAGGCTCTGGAGAAGCAGAAGAAGATGAAGATACAATGTTCACCATGGTAACTGATTTATCACAGAGAAATACTACTGATACACTCATTACTTTAGACACTAGCAGGATAATCACAGAAAGCTTTTTTGAGGTTCCTGCAACCACCATTTATCCAGTTTCTGAACAACCTTCTGCAAAAGTGGTGCCTACCAAGTTTGTAAGTGAAACAGACACTTCTGAGTGGATTTCCAGTACCACTGTTGAGGAAAAGAAAAGGAAGGAGGAGGAGGGAACTACAGGTACGGCTTCTACATTTGAGGTATATTCATCTACACAGAGATCGGATCAATTAATTTTACCCTTTGAATTAGAAAGTCCAAATGTAGCTACATCTAGTGATTCAGGTACCAGGAAAAGTTTTATGTCCTTGACAACACCAACACAGTCTGAAAGGGAAATGACAGATTCTACTCCTGTCTTTACAGAAACAAATACATTAGAAAATTTGGGGGCACAGACCACTGAGCACAGCAGTATCCATCAACCTGGGGTTCAGGAAGGGCTGACCACTCTCCCACGTAGTCCTGCCTCTGTCTTTATGGAGCAGGGCTCTGGAGAAGCTGCTGCCGACCCAGAAACCACCACTGTTTCTTCATTTTCATTAAACGTAGAGTATGCAATTCAAGCCGAAAAGGAAGTAGCTGGCACTTTGTCTCCGCATGTGGAAACTACATTCTCCACTGAGCCAACAGGACTGGTTTTGAGTACAGTAATGGACAGAGTAGTTGCTGAAAATATAACCCAAACATCCAGGGAAATAGTGATTTCAGAGCGATTAGGAGAACCAAATTATGGGGCAGAAATAAGGGGCTTTTCCACAGGTTTTCCTTTGGAGGAAGATTTCAGTGGTGACTTTAGAGAATACTCAACAGTGTCTCATCCCATAGCAAAAGAAGAAACGGTAATGATGGAAGGCTCTGGAGATGCAGCATTTAGGGACACCCAGACTTCACCATCTACAGTACCTACTTCAGTTCACATCAGTCACATATCTGACTCAGAAGGACCCAGTAGCACCATGGTCAGCACTTCAGCCTTCCCCTGGGAAGAGTTTACATCCTCAGCTGAGGGCTCAGGTGAGCAACTGGTCACAGTCAGCAGCTCTGTTGTTCCAGTGCTTCCCAGTGCTGTGCAAAAGTTTTCTGGTACAGCTTCCTCCATTATCGACGAAGGATTGGGAGAAGTGGGTACTGTCAATGAAATTGATAGAAGATCCACCATTTTACCAACAGCAGAAGTGGAAGGTACGAAAGCTCCAGTAGAGAAGGAGGAAGTAAAGGTCAGTGGCACAGTTTCAACAAACTTTCCCCAAACTATAGAGCCAGCCAAATTATGGTCTAGGCAAGAAGTCAACCCTGTAAGACAAGAAATTGAAAGTGAAACAACATCAGAGGAACAAATTCAAGAAGAAAAGTCATTTGAATCCCCTCAAAACTCTCCTGCAACAGAACAAACAATCTTTGATTCACAGACATTTACTGAAACTGAACTCAAAACCACAGATTATTCTGTACTAACAACAAAGAAAACTTACAGTGATGATAAAGAAATGAAGGAGGAAGACACTTCTTTAGTTAACATGTCTACTCCAGATCCAGATGCAAATGGCTTGGAATCTTACACAACTCTCCCTGAAGCTACTGAAAAGTCACATTTTTTCTTAGCTACTGCATTAGTAACTGAATCTATACCAGCTGAACATGTAGTCACAGATTCACCAATCAAAAAGGAAGAAAGTACAAAACATTTTCCGAAAGGCATGAGACCAACAATTCAAGAGTCAGATACTGAGCTCTTATTCTCTGGACTGGGATCAGGAGAAGAAGTTTTACCTACTCTACCAACAGAGTCAGTGAATTTTACTGAAGTGGAACAAATCAATAACACATTATATCCCCACACTTCTCAAGTGGAAAGTACCTCAAGTGACAAAATTGAAGACTTTAACAGAATGGAAAATGTGGCAAAAGAAGTTGGACCACTCGTATCTCAAACAGACATCTTTGAAGGTAGTGGGTCAGTAACCAGCACAACATTAATAGAAATTTTAAGTGACACTGGAGCAGAAGGACCCACGGTGGCACCTCTCCCTTTCTCCACGGACATCGGACATCCTCAAAATCAGACTGTCAGGTGGGCAGAAGAAATCCAGACTAGTAGACCACAAACCATAACTGAACAAGACTCTAACAAGAATTCTTCAACAGCAGAAATTAACGAAACAACAACCTCATCTACTGATTTTCTGGCTAGAGCTTATGGTTTTGAAATGGCCAAAGAATTTGTTACATCAGCACCAAAACCATCTGACTTGTATTATGAACCTTCTGGAGAAGGATCTGGAGAAGTGGATATTGTTGATTCATTTCACACTTCTGCAACTACTCAGGCAACCAGACAAGAAAGCAGCACCACATTTGTTTCTGATGGGTCCCTGGAAAAACATCCTGAGGTGCCAAGCGCTAAAGCTGTTACTGCTGATGGATTCCCAACAGTTTCAGTGATGCTGCCTCTTCATTCAGAGCAGAACAAAAGCTCCCCTGATCCAACTAGCACACTGTCAAATACAGTGTCATATGAGAGGTCCACAGACGGTAGTTTCCAAGACCGTTTCAGGGAATTCGAGGATTCCACCTTAAAACCTAACAGAAAAAAACCCACTGAAAATATTATCATAGACCTGGACAAAGAGGACAAGGATTTAATATTGACAATTACAGAGAGTACCATCCTTGAAATTCTACCTGAGCTGACATCGGATAAAAATACTATCATAGATATTGATCATACTAAACCTGTGTATGAAGACATTCTTGGAATGCAAACAGATATAGATACAGAGGTACCATCAGAACCACATGACAGTAATGATGAAAGTAATGATGACAGCACTCAAGTTCAAGAGATCTATGAGGCAGCTGTCAACCTTTCTTTAACTGAGGAAACATTTGAGGGCTCTGCTGATGTTCTGGCTAGCTACACTCAGGCAACACATGATGAATCAATGACTTATGAAGATAGAAGCCAACTAGATCACATGGGCTTTCACTTCACAACTGGGATCCCTGCTCCTAGCACAGAAACAGAATTAGACGTTTTACTTCCCACGGCAACATCCCTGCCAATTCCTCGTAAGTCTGCCACAGTTATTCCAGAGATTGAAGGAATAAAAGCTGAAGCAAAAGCCCTGGATGACATGTTTGAATCAAGCACTTTGTCTGATGGTCAAGCTATTGCAGACCAAAGTGAAATAATACCAACATTGGGCCAATTTGAAAGGACTCAGGAGGAGTATGAAGACAAAAAACATGCTGGTCCTTCTTTTCAGCCAGAATTCTCTTCAGGAGCTGAGGAGGCATTAGTAGACCATACTCCCTATCTAAGTATTGCTACTACCCACCTTATGGATCAGAGTGTAACAGAGGTGCCTGATGTGATGGAAGGATCCAATCCCCCATATTACACTGATACAACATTAGCAGTTTCAACATTTGCGAAGTTGTCTTCTCAGACACCATCATCTCCCCTCACTATCTACTCAGGCAGTGAAGCCTCTGGACACACAGAGATCCCCCAGCCCAGTGCTCTGCCAGGAATAGACGTCGGCTCATCTGTAATGTCCCCACAGGATTCTTTTAAGGAAATTCATGTAAATATTGAAGCGACTTTCAAACCATCAAGTGAGGAATACCTTCACATAACTGAGCCTCCCTCTTTATCTCCTGACACAAAATTAGAACCTTCAGAAGATGATGGTAAACCTGAGTTATTAGAAGAAATGGAAGCTTCTCCCACAGAACTTATTGCTGTGGAAGGAACTGAGATTCTCCAAGATTTCCAAAACAAAACCGATGGTCAAGTTTCTGGAGAAGCAATCAAGATGTTTCCCACCATTAAAACACCTGAGGCTGGAACTGTTATTACAACTGCCGATGAAATTGAATTAGAAGGTGCTACACAGTGGCCACACTCTACTTCTGCTTCTGCCACCTATGGGGTCGAGGCAGGTGTGGTGCCTTGGCTAAGTCCACAGACTTCTGAGAGGCCCACGCTTTCTTCTTCTCCAGAAATAAACCCTGAAACTCAAGCAGCTTTAATCAGAGGGCAGGATTCCACGATAGCAGCATCAGAACAGCAAGTGGCAGCGAGAATTCTTGATTCCAATGATCAGGCAACAGTAAACCCTGTGGAATTTAATACTGAGGTTGCAACACCACCATTTTCCCTTCTGGAGACTTCTAATGAAACAGATTTCCTGATTGGCATTAATGAAGAGTCAGTGGAAGGCACGGCAATCTATTTACCAGGACCTGATCGCTGCAAAATGAACCCGTGCCTTAACGGAGGCACCTGTTATCCTACTGAAACTTCCTACGTATGCACCTGTGTGCCAGGATACAGCGGAGACCAGTGTGAACTTGATTTTGATGAATGTCACTCTAATCCCTGTCGTAATGGAGCCACTTGTGTTGATGGTTTTAACACATTCAGGTGCCTCTGCCTTCCAAGTTATGTTGGTGCACTTTGTGAGCAAGATACCGAGACATGTGACTATGGCTGGCACAAATTCCAAGGGCAGTGCTACAAATACTTTGCCCATCGACGCACATGGGATGCAGCTGAACGGGAATGCCGTCTGCAGGGTGCCCATCTCACAAGCATCCTGTCTCACGAAGAACAAATGTTTGTTAATCGTGTGGGCCATGATTATCAGTGGATAGGCCTCAATGACAAGATGTTTGAGCATGACTTCCGTTGGACTGATGGCAGCACACTGCAATACGAGAATTGGAGACCCAACCAGCCAGACAGCTTCTTTTCTGCTGGAGAAGACTGTGTTGTAATCATTTGGCATGAGAATGGCCAGTGGAATGATGTTCCCTGCAATTACCATCTCACCTATACGTGCAAGAAAGGAACAGTCGCTTGCGGCCAGCCCCCTGTTGTAGAAAATGCCAAGACCTTTGGAAAGATGAAACCTCGTTATGAAATCAACTCCCTGATTAGATACCACTGCAAAGATGGTTTCATTCAACGTCACCTTCCAACTATCCGGTGCTTAGGAAATGGAAGATGGGCTATACCTAAAATTACCTGCATGAACCCATCTGCATACCAAAGGACTTATTCTATGAAATACTTTAAAAATTCCTCATCAGCAAAGGACAATTCAATAAATACATCCAAACATGATCATCGTTGGAGCCGGAGGTGGCAGGAGTCGAGGCGCTGATCCCTAAAATGGCGAACATGTGTTTTCATCATTTCAGCCAAAGTCCTAACTTCCTGTGCCTTTCCTATCACCTCGAGAAGTAATTATCAGTTGGTTTGGATTTTTGGACCACCGTTCAGTCATTTTGGGTTGCCGTGCTCCCAAAACATTTTAAATGAAAGTATTGGCATTCAAAAAGACAGCAGACAAAATGAAAGAAAATGAGAGCAGAAAGTAAGCATTTCCAGCCTATCTAATTTCTTTAGTTTTCTATTTGCCTCCAGTGCAGTCCATTTCCTAATGTATACCAGCCTACTGTACTATTTAAAATGCTCAATTTCAGCACCGATGGCCATGTAAATAAGATGATTTAATGTTGATTTTAATCCTGTATATAAAATAAAAAGTCACAATGAGTTTGGGCATATTTAATGATGATTATGGAGCCTTAGAGGTCTTTAATCATTGGTTCGGCTGCTTTTATGTAGTTTAGGCTGGAAATGGTTTCACTTGCTCTTTGACTGTCAGCAAGACTGAAGATGGCTTTTCCTGGACAGCTAGAAAACACAAAATCTTGTAGGTCATTGCACCTATCTCAGCCATAGGTGCAGTTTGCTTCTACATGATGCTAAAGGCTGCGAATGGGATCCTGATGGAACTAAGGACTCCAATGTCGAACTCTTCTTTGCTGCATTCCTTTTTCTTCACTTACAAGAAAGGCCTGAATGGAGGACTTTTCTGTAACCAGGAACATTTTTTAGGGGTCAAAGTGCTAATAATTAACTCAACCAGGTCTACTTTTTAATGGCTTTCATAACACTAACTCATAAGGTTACCGATCAATGCATTTCATACGGATATAGACCTAGGGCTCTGGAGGGTGGGGGATTGTTAAAACACATGC