Transcript asmbl_119413

Sequence
Transcript Sequence for observation asmbl_119413 of TGE0056944:
GGGGAGCGCTGCTGTCCCCAAGCCGATTGGTACTTCTTGTCAGGAAGAAACGCCAAGAGGTGGGAGTGCCTGGGGAGGGAGGCAGGCGGTCCCTACCGCAGGCGCGGGGAGCTGCCTTTCCGCCCCTCCGCCTGCTTTCCAAGCCTGGACTCTTAGGAGTGGCTGAAGCTGCGGAGCGCTTTTGGAGCCTGTGAATGAACCCTCCTCCTCTCCCTCCTCCTTCTTCTCGCTGAGTCTCCTCCTCGGCTCTGACGGTACAGTGATATAATGATGATGGGTGTCACAACCCGCATTTGAACTTGCAGGCGAGCTGCCCCGAGCCTTTCTGGGGAAGAACTCCAGGCGTGCGGACGCAACAGCCGAGAACATTAGGTGTTGTGGACAGGAGCTGGGACCAAGATCTTCGGCCAGCCCCGCATCCTCCCGCATCTTCCAGCACCGTCCCGCACCCTCCGCATCCTTCCCCGGGCCACCACGCTTCCTATGTGACCCGCCTGGGCAACGCCGAACCCAGTCGCGCAGCGCTGCAGTGAATTTTCCCCCCAAACTGCAATAAGCCGCCTTCCAAGGCCAAGATGTTCATAAATATAAAGAGCATCTTATGGATGTGTTCAACCTTAATAGTAACCCATGCGCTACATAAAGTCAAAGTGGGAAAAAGCCCACCGGTGAGGGGCTCCCTCTCTGGAAAAGTCAGCCTACCTTGTCATTTTTCAACGATGCCTACTTTGCCACCCAGTTACAACACCAGTGAATTTCTCCGCATCAAATGGTCTAAGATTGAAGTGGACAAAAATGGAAAAGATTTGAAAGAGACTACTGTCCTTGTGGCCCAAAATGGAAATATCAAGATTGGTCAGGACTACAAAGGGAGAGTGTCTGTGCCCACACATCCCGAGGCTGTGGGCGATGCCTCCCTCACTGTGGTCAAGCTGCTGGCAAGTGATGCGGGTCTTTACCGCTGTGACGTCATGTACGGGATTGAAGACACACAAGACACGGTGTCACTGACTGTGGATGGGGTTGTGTTTCACTACAGGGCGGCAACCAGCAGGTACACACTGAATTTTGAGGCTGCTCAGAAGGCTTGTTTGGACGTTGGGGCAGTCATAGCAACTCCAGAGCAGCTCTTTGCTGCCTATGAAGATGGATTTGAGCAGTGTGACGCAGGCTGGCTGGCTGATCAGACTGTCAGATATCCCATCCGGGCTCCCAGAGTAGGCTGTTATGGAGATAAGATGGGAAAGGCAGGAGTCAGGACTTATGGATTCCGTTCTCCCCAGGAAACTTACGATGTGTATTGTTATGTGGATCATCTGGATGGTGATGTGTTCCACCTCACTGTCCCCAGTAAATTCACCTTCGAGGAGGCTGCAAAAGAGTGTGAAAACCAGGATGCCAGGCTGGCAACAGTGGGGGAACTCCAGGCGGCATGGAGGAACGGCTTTGACCAGTGCGATTACGGGTGGCTGTCGGATGCCAGCGTGCGCCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGTGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACAGGCTTCCCTCCCCCTGATAGCAGATTTGATGCCTACTGCTTTAAACGTCGAATGAGTGATTTGAGTGTAATTGGTCATCCAATAGATTCAGAATCTAAAGAAGATGAACCTTGTAGTGAAGAAACAGATCCAGTGCATGATCTAATGGCTGAAATTTTACCTGAATTCCCTGACATAATTGAAATAGACCTATACCACAGTGAAGAAAATGAAGAAGAAGAAGAAGAGTGTGCAAATGCTACTGATGTGACAACCACCCCATCTGTGCAGTACATAAATGGGAAGCATCTCGTTACCACTGTGCCCAAGGACCCAGAAGCTGCAGAAGCTAGGCGTGGCCAGTTTGAAAGTGTTGCACCTTCTCAGAATTTCTCGGACAGCTCTGAAAGTGATACTCATCCATTTGTAATAGCCAAAACGGAATTGTCTACTGCTGTGCAACCTAATGAATCTACAGAAACAACTGAGTCTCTTGAAGTTACATGGAAGCCTGAGACTTACCCTGAAACATCAGAACATTTTTCAGGTGGTGAGCCTGATGTTTTCCCCACAGTCCCATTCCATGAGGAATTTGAAAGTGGAACAGCCAAAAAAGGGGCAGAATCAGTCACAGAGAGAGATACTGAAGTTGGTCATCAGGCACATGAACATACTGAACCTGTATCTCTGTTTCCTGAAGAGTCTTCAGGAGAGATTGCCATTGACCAAGAATCTCAGAAAATAGCCTTTGCAAGGGCTACAGAAGTAACATTTGGTGAAGAGGTAGAAAAAAGTACTTCTGTCACATACACTCCCACTATAGTTCCAAGTTCTGCATCAGCATATGTTTCAGAGGAAGAAGCAGTTACCCTAATAGGAAATCCTTGGCCAGATGACCTGTTGTCTACCAAAGAAAGCTGGGTAGAAGCAACTCCTAGACAAGTTGTAGAGCTCTCAGGGAGTTCTTCGATTCCAATTACAGAAGGCTCTGGAGAAGCAGAAGAAGATGAAGATACAATGTTCACCATGGTAACTGATTTATCACAGAGAAATACTACTGATACACTCATTACTTTAGACACTAGCAGGATAATCACAGAAAGCTTTTTTGAGGTTCCTGCAACCACCATTTATCCAGTTTCTGAACAACCTTCTGCAAAAGTGGTGCCTACCAAGTTTGTAAGTGAAACAGACACTTCTGAGTGGATTTCCAGTACCACTGTTGAGGAAAAGAAAAGGAAGGAGGAGGAGGGAACTACAGGTACGGCTTCTACATTTGAGGTATATTCATCTACACAGAGATCGGATCAATTAATTTTACCCTTTGAATTAGAAAGTCCAAATGTAGCTACATCTAGTGATTCAGGTACCAGGAAAAGTTTTATGTCCTTGACAACACCAACACAGTCTGAAAGGGAAATGACAGATTCTACTCCTGTCTTTACAGAAACAAATACATTAGAAAATTTGGGGGCACAGACCACTGAGCACAGCAGTATCCATCAACCTGGGGTTCAGGAAGGGCTGACCACTCTCCCACGTAGTCCTGCCTCTGTCTTTATGGAGCAGGGCTCTGGAGAAGCTGCTGCCGACCCAGAAACCACCACTGTTTCTTCATTTTCATTAAACGTAGAGTATGCAATTCAAGCCGAAAAGGAAGTAGCTGGCACTTTGTCTCCGCATGTGGAAACTACATTCTCCACTGAGCCAACAGGACTGGTTTTGAGTACAGTAATGGACAGAGTAGTTGCTGAAAATATAACCCAAACATCCAGGGAAATAGTGATTTCAGAGCGATTAGGAGAACCAAATTATGGGGCAGAAATAAGGGGCTTTTCCACAGGTTTTCCTTTGGAGGAAGATTTCAGTGGTGACTTTAGAGAATACTCAACAGTGTCTCATCCCATAGCAAAAGAAGAAACGGTAATGATGGAAGGCTCTGGAGATGCAGCATTTAGGGACACCCAGACTTCACCATCTACAGTACCTACTTCAGTTCACATCAGTCACATATCTGACTCAGAAGGACCCAGTAGCACCATGGTCAGCACTTCAGCCTTCCCCTGGGAAGAGTTTACATCCTCAGCTGAGGGCTCAGGTGAGCAACTGGTCACAGTCAGCAGCTCTGTTGTTCCAGTGCTTCCCAGTGCTGTGCAAAAGTTTTCTGGTACAGCTTCCTCCATTATCGACGAAGGATTGGGAGAAGTGGGTACTGTCAATGAAATTGATAGAAGATCCACCATTTTACCAACAGCAGAAGTGGAAGGTACGAAAGCTCCAGTAGAGAAGGAGGAAGTAAAGGTCAGTGGCACAGTTTCAACAAACTTTCCCCAAACTATAGAGCCAGCCAAATTATGGTCTAGGCAAGAAGTCAACCCTGTAAGACAAGAAATTGAAAGTGAAACAACATCAGAGGAACAAATTCAAGAAGAAAAGTCATTTGAATCCCCTCAAAACTCTCCTGCAACAGAACAAACAATCTTTGATTCACAGACATTTACTGAAACTGAACTCAAAACCACAGATTATTCTGTACTAACAACAAAGAAAACTTACAGTGATGATAAAGAAATGAAGGAGGAAGACACTTCTTTAGTTAACATGTCTACTCCAGATCCAGATGCAAATGGCTTGGAATCTTACACAACTCTCCCTGAAGCTACTGAAAAGTCACATTTTTTCTTAGCTACTGCATTAGTAACTGAATCTATACCAGCTGAACATGTAGTCACAGATTCACCAATCAAAAAGGAAGAAAGTACAAAACATTTTCCGAAAGGCATGAGACCAACAATTCAAGAGTCAGATACTGAGCTCTTATTCTCTGGACTGGGATCAGGAGAAGAAGTTTTACCTACTCTACCAACAGAGTCAGTGAATTTTACTGAAGTGGAACAAATCAATAACACATTATATCCCCACACTTCTCAAGTGGAAAGTACCTCAAGTGACAAAATTGAAGACTTTAACAGAATGGAAAATGTGGCAAAAGAAGTTGGACCACTCGTATCTCAAACAGACATCTTTGAAGGTAGTGGGTCAGTAACCAGCACAACATTAATAGAAATTTTAAGTGACACTGGAGCAGAAGGACCCACGGTGGCACCTCTCCCTTTCTCCACGGACATCGGACATCCTCAAAATCAGACTGTCAGGTGGGCAGAAGAAATCCAGACTAGTAGACCACAAACCATAACTGAACAAGACTCTAACAAGAATTCTTCAACAGCAGAAATTAACGAAACAACAACCTCATCTACTGATTTTCTGGCTAGAGCTTATGGTTTTGAAATGGCCAAAGAATTTGTTACATCAGCACCAAAACCATCTGACTTGTATTATGAACCTTCTGGAGAAGGATCTGGAGAAGTGGATATTGTTGATTCATTTCACACTTCTGCAACTACTCAGGCAACCAGACAAGAAAGCAGCACCACATTTGTTTCTGATGGGTCCCTGGAAAAACATCCTGAGGTGCCAAGCGCTAAAGCTGTTACTGCTGATGGATTCCCAACAGTTTCAGTGATGCTGCCTCTTCATTCAGAGCAGAACAAAAGCTCCCCTGATCCAACTAGCACACTGTCAAATACAGTGTCATATGAGAGGTCCACAGACGGTAGTTTCCAAGACCGTTTCAGGGAATTCGAGGATTCCACCTTAAAACCTAACAGAAAAAAACCCACTGAAAATATTATCATAGACCTGGACAAAGAGGACAAGGATTTAATATTGACAATTACAGAGAGTACCATCCTTGAAATTCTACCTGAGCTGACATCGGATAAAAATACTATCATAGATATTGATCATACTAAACCTGTGTATGAAGACATTCTTGGAATGCAAACAGATATAGATACAGAGGTACCATCAGAACCACATGACAGTAATGATGAAAGTAATGATGACAGCACTCAAGTTCAAGAGATCTATGAGGCAGCTGTCAACCTTTCTTTAACTGAGGAAACATTTGAGGGCTCTGCTGATGTTCTGGCTAGCTACACTCAGGCAACACATGATGAATCAATGACTTATGAAGATAGAAGCCAACTAGATCACATGGGCTTTCACTTCACAACTGGGATCCCTGCTCCTAGCACAGAAACAGAATTAGACGTTTTACTTCCCACGGCAACATCCCTGCCAATTCCTCGTAAGTCTGCCACAGTTATTCCAGAGATTGAAGGAATAAAAGCTGAAGCAAAAGCCCTGGATGACATGTTTGAATCAAGCACTTTGTCTGATGGTCAAGCTATTGCAGACCAAAGTGAAATAATACCAACATTGGGCCAATTTGAAAGGACTCAGGAGGAGTATGAAGACAAAAAACATGCTGGTCCTTCTTTTCAGCCAGAATTCTCTTCAGGAGCTGAGGAGGCATTAGTAGACCATACTCCCTATCTAAGTATTGCTACTACCCACCTTATGGATCAGAGTGTAACAGAGGTGCCTGATGTGATGGAAGGATCCAATCCCCCATATTACACTGATACAACATTAGCAGTTTCAACATTTGCGAAGTTGTCTTCTCAGACACCATCATCTCCCCTCACTATCTACTCAGGCAGTGAAGCCTCTGGACACACAGAGATCCCCCAGCCCAGTGCTCTGCCAGGAATAGACGTCGGCTCATCTGTAATGTCCCCACAGGATTCTTTTAAGGAAATTCATGTAAATATTGAAGCGACTTTCAAACCATCAAGTGAGGAATACCTTCACATAACTGAGCCTCCCTCTTTATCTCCTGACACAAAATTAGAACCTTCAGAAGATGATGGTAAACCTGAGTTATTAGAAGAAATGGAAGCTTCTCCCACAGAACTTATTGCTGTGGAAGGAACTGAGATTCTCCAAGATTTCCAAAACAAAACCGATGGTCAAGTTTCTGGAGAAGCAATCAAGATGTTTCCCACCATTAAAACACCTGAGGCTGGAACTGTTATTACAACTGCCGATGAAATTGAATTAGAAGGTGCTACACAGTGGCCACACTCTACTTCTGCTTCTGCCACCTATGGGGTCGAGGCAGGTGTGGTGCCTTGGCTAAGTCCACAGACTTCTGAGAGGCCCACGCTTTCTTCTTCTCCAGAAATAAACCCTGAAACTCAAGCAGCTTTAATCAGAGGGCAGGATTCCACGATAGCAGCATCAGAACAGCAAGTGGCAGCGAGAATTCTTGATTCCAATGATCAGGCAACAGTAAACCCTGTGGAATTTAATACTGAGGTTGCAACACCACCATTTTCCCTTCTGGAGACTTCTAATGAAACAGATTTCCTGATTGGCATTAATGAAGAGTCAGTGGAAGGCACGGCAATCTATTTACCAGGACCTGATCGCTGCAAAATGAACCCGTGCCTTAACGGAGGCACCTGTTATCCTACTGAAACTTCCTACGTATGCACCTGTGTGCCAGGATACAGCGGAGACCAGTGTGAACTTGATTTTGATGAATGTCACTCTAATCCCTGTCGTAATGGAGCCACTTGTGTTGATGGTTTTAACACATTCAGGTGCCTCTGCCTTCCAAGTTATGTTGGTGCACTTTGTGAGCAAGATACCGAGACATGTGACTATGGCTGGCACAAATTCCAAGGGCAGTGCTACAAATACTTTGCCCATCGACGCACATGGGATGCAGCTGAACGGGAATGCCGTCTGCAGGGTGCCCATCTCACAAGCATCCTGTCTCACGAAGAACAAATGTTTGTTAATCGTGTGGGCCATGATTATCAGTGGATAGGCCTCAATGACAAGATGTTTGAGCATGACTTCCGTTGGACTGATGGCAGCACACTGCAATACGAGAATTGGAGACCCAACCAGCCAGACAGCTTCTTTTCTGCTGGAGAAGACTGTGTTGTAATCATTTGGCATGAGAATGGCCAGTGGAATGATGTTCCCTGCAATTACCATCTCACCTATACGTGCAAGAAAGGAACAGTCGCTTGCGGCCAGCCCCCTGTTGTAGAAAATGCCAAGACCTTTGGAAAGATGAAACCTCGTTATGAAATCAACTCCCTGATTAGATACCACTGCAAAGATGGTTTCATTCAACGTCACCTTCCAACTATCCGGTGCTTAGGAAATGGAAGATGGGCTATACCTAAAATTACCTGCATGAACCCATCTGCATACCAAAGGACTTATTCTATGAAATACTTTAAAAATTCCTCATCAGCAAAGGACAATTCAATAAATACATCCAAACATGATCATCGTTGGAGCCGGAGGTGGCAGGAGTCGAGGCGCTGATCCCTAAAATGGCGAACATGTGTTTTCATCATTTCAGCCAAAGTCCTAACTTCCTGTGCCTTTCCTATCACCTCGAGAAGTAATTATCAGTTGGTTTGGATTTTTGGACCACCGTTCAGTCATTTTGGGTTGCCGTGCTCCCAAAACATTTTAAATGAAAGTATTGGCATTCAAAAAGACAGCAGACAAAATGAAAGAAAATGAGAGCAGAAAGTAAGCATTTCCAGCCTATCTAATTTCTTTAGTTTTCTATTTGCCTCCAGTGCAGTCCATTTCCTAATGTATACCAGCCTACTGTACTATTTAAAATGCTCAATTTCAGCACCGATGGCCATGTAAATAAGATGATTTAATGTTGATTTTAATCCTGTATATAAAATAAAAAGTCACAATGAGTTTGGGCATATTTAATGATGATTATGGAGCCTTAGAGGTCTTTAATCATTGGTTCGGCTGCTTTTATGTAGTTTAGGCTGGAAATGGTTTCACTTGCTCTTTGACTGTCAGCAAGACTGAAGATGGCTTTTCCTGGACAGCTAGAAAACACAAAATCTTGTAGGTCATTGCACCTATCTCAGCCATAGGTGCAGTTTGCTTCTACATGATGCTAAAGGCTGCGAATGGGATCCTGATGGAACTAAGGACTCCAATGTCGAACTCTTCTTTGCTGCATTCCTTTTTCTTCACTTACAAGAAAGGCCTGAATGGAGGACTTTTCTGTAACCAGGAACATTTTTTAGGGGTCAAAGTGCTAATAATTAACTCAACCAGGTCTACTTTTTAATGGCTTTCATAACACTAACTCATAAGGTTACCGATCAATGCATTTCATACGGATATAGACCTAGGGCTCTGGAGGGTGGGGGATTGTTAAAACACATGC