Transcript asmbl_119411

Sequence
Transcript Sequence for observation asmbl_119411 of TGE0059543:
GGGGAGCGCTGCTGTCCCCAAGCCGATTGGTACTTCTTGTCAGGAAGAAACGCCAAGAGGTGGGAGTGCCTGGGGAGGGAGGCAGGCGGTCCCTACCGCAGGCGCGGGGAGCTGCCTTTCCGCCCCTCCGCCTGCTTTCCAAGCCTGGACTCTTAGGAGTGGCTGAAGCTGCGGAGCGCTTTTGGAGCCTGTGAATGAACCCTCCTCCTCTCCCTCCTCCTTCTTCTCGCTGAGTCTCCTCCTCGGCTCTGACGGTACAGTGATATAATGATGATGGGTGTCACAACCCGCATTTGAACTTGCAGGCGAGCTGCCCCGAGCCTTTCTGGGGAAGAACTCCAGGCGTGCGGACGCAACAGCCGAGAACATTAGGTGTTGTGGACAGGAGCTGGGACCAAGATCTTCGGCCAGCCCCGCATCCTCCCGCATCTTCCAGCACCGTCCCGCACCCTCCGCATCCTTCCCCGGGCCACCACGCTTCCTATGTGACCCGCCTGGGCAACGCCGAACCCAGTCGCGCAGCGCTGCAGTGAATTTTCCCCCCAAACTGCAATAAGCCGCCTTCCAAGGCCAAGATGTTCATAAATATAAAGAGCATCTTATGGATGTGTTCAACCTTAATAGTAACCCATGCGCTACATAAAGTCAAAGTGGGAAAAAGCCCACCGGTGAGGGGCTCCCTCTCTGGAAAAGTCAGCCTACCTTGTCATTTTTCAACGATGCCTACTTTGCCACCCAGTTACAACACCAGTGAATTTCTCCGCATCAAATGGTCTAAGATTGAAGTGGACAAAAATGGAAAAGATTTGAAAGAGACTACTGTCCTTGTGGCCCAAAATGGAAATATCAAGATTGGTCAGGACTACAAAGGGAGAGTGTCTGTGCCCACACATCCCGAGGCTGTGGGCGATGCCTCCCTCACTGTGGTCAAGCTGCTGGCAAGTGATGCGGGTCTTTACCGCTGTGACGTCATGTACGGGATTGAAGACACACAAGACACGGTGTCACTGACTGTGGATGGGGTTGTGTTTCACTACAGGGCGGCAACCAGCAGGTACACACTGAATTTTGAGGCTGCTCAGAAGGCTTGTTTGGACGTTGGGGCAGTCATAGCAACTCCAGAGCAGCTCTTTGCTGCCTATGAAGATGGATTTGAGCAGTGTGACGCAGGCTGGCTGGCTGATCAGACTGTCAGATATCCCATCCGGGCTCCCAGAGTAGGCTGTTATGGAGATAAGATGGGAAAGGCAGGAGTCAGGACTTATGGATTCCGTTCTCCCCAGGAAACTTACGATGTGTATTGTTATGTGGATCATCTGGATGGTGATGTGTTCCACCTCACTGTCCCCAGTAAATTCACCTTCGAGGAGGCTGCAAAAGAGTGTGAAAACCAGGATGCCAGGCTGGCAACAGTGGGGGAACTCCAGGCGGCATGGAGGAACGGCTTTGACCAGTGCGATTACGGGTGGCTGTCGGATGCCAGCGTGCGCCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGTGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACAGGCTTCCCTCCCCCTGATAGCAGATTTGATGCCTACTGCTTTAAACGACCTGATCGCTGCAAAATGAAC