Transcript asmbl_11912

Sequence
Transcript Sequence for observation asmbl_11912 of TGE0059542:
CAGGCTACTCCCACCCCGCCCCGCCCCGTCATTGTCCCCGTCGGTCTCTTTTCTCTTCCGTCCTAAAAGCTCTGCGAGCCGCTCCCTTCTCCCGGTGCCCCGCGTCTGTCCATCCTCAGTGGGTCAGACGAGCAGGATGGAGGGCTGCATGGGGGAGGAGTCGTTTCAGATGTGGGAGCTCAATCGGCGCCTGGAGGCCTACCTGGCCCGGGTCAAGGCGCTGGAGGAGCAGAATGAGCTGCTCAGCGCGGAGCTCGGGGGGCTCCGGGCACAATCCGCGGACACCTCCTGGCGGGCGCATGCCGACGACGAGCTGGCGGCCCTGCGGGCCCTCGTTGACCAACGCTGGCGGGAGAAGCACGCGGCCGAGGTGGCGCGCGACAACCTGGCTGAAGAGCTGGAGGGCGTGGCAGGCCGATGCCAGCAGCTGCGGCTGGCCCGGGAGCGGACGACGGAGGAGGTAGCCCGCAACCGGCGCGCCGTCGAGGCAGAGAAATGCGCCCGGGCCTGGCTGAGTAGCCAGGTGGCAGAGCTGGAGCGCGAGCTAGAGGCTCTACGCGTGGCGCACGAGGAGGAGCGCGTCGGCCTGAACGCGCAGGCTGCCTGTGCCCCCCGCTGCCCCGCGCCGCCCCGCGGGCCTCCCGCGCCGGCCCCGGAGGTAGAGGAGCTGGCAAGGCGACTGGGCGAGGCGTGGCGCGGGGCAGTGCGCGGCTACCAGGAGCGCGTGGCACACATGGAGACGTCGCTGGGCCAGGCCCGCGAGCGGCTGGGCCGGGCGGTGCAGGGTGCCCGCGAGGGCCGCCTGGAGCTGCAGCAGCTCCAGGCTGAGCGCGGAGGCCTCCTGGAGCGCAGGGCAGCGTTGGAACAGAGGTTGGAGGGCCGCTGGCAGGAGCGGCTGCGGGCTACTGAAAAGTTCCAGCTGGCTGTGGAGGCCCTGGAGCAGGAGAAACAGGGCCTACAGAGCCAGATCGCTCAGGTCCTGGAAGGTCGGCAGCAGCTGGCGCACCTCAAGATGTCCCTCAGCCTGGAGGTGGCCACGTACAGGACCCTCCTGGAGGCTGAGAACTCCCGGCTGCAAACACCTGGCGGTGGCTCCAAGACTTCCCTCAGCTTTCAGGACCCCAAGCTGGAGCTGCAATTCCCTAGGACCCCAGAGGGCCGGCGTCTTGGATCTTTGCTCCCAGTCCTGAGCCCAACTTCCCTCCCCTCACCCTTGCCTGCTACCCTTGAGACACCTGTGCCAGCCTTTCTTAAGAACCAAGAATTCCTCCAGGCCCGTACCCCTACCTTGGCCAGCACCCCCATCCCCCCCACACCTCAGGCACCCTCTCCTGCTGTAGATGCAGAGATCAGAGCCCAGGATGCTCCTCTCTCTCTGCTCCAGACACAGGGTGGGAGGAAACAGGCTCCAGAGCCCCTGCGGGCTGAAGCCAGGGTGGCCATTCCTGCCAGCGTCCTGCCTGGACCAGAGGAGCCTGGGGGCCAGCGGCAAGAGGCCAGTACAGGCCAGTCCCCAGAGGACCATGCCTCCTTGGCACCACCCCTCAGCCCTGACCACTCCAGTTTAGAGGCTAAGGATGGAGAATCCGGTGGGTCTAGAGTGTTCAGCATATGCCGAGGGGAAGGTGAAGGGCAAATCTGGGGGTTGGTAGAGAAAGAAACAGCCATAGAGGGCAAAGTGGTAAGCAGCTTGCAGCAGGAAATATGGGAAGAAGAGGATCTAAACAGGAAGGAAATCCAGGACTCCCAGGTTCCTTTGGAAAAAGAAACCCTGAAGTCTCTGGGAGAGGAGATTCAAGAGTCACTGAAGACTCTGGAAAACCAGAGCCATGAGACACTAGAAAGGGAGAATCAAGAATGTCCGAGGTCTTTAGAAGAAGACTTAGAAACACTAAAAAGTCTAGAAAAGGAAAATAAAGAGCTATTAAAGGATGTGGAGGTAGTGAGACCTCTAGAAAAAGAGGCTGTAGGCCAACTTAAGCCTACAGGAAAAGAGGACACACAGACATTGCAATCCCTGCAAAAGGAGAATCAAGAACTAATGAAATCTCTTGAAGGTAATCTAGAGACATTTTTATTTCCAGGAACGGAAAATCAAGAATTAGTAAGTTCTCTGCAAGAGAACTTAGAGTCATTGACAGCTCTGGAAAAGGAGAATCAAGAGCCACTGAGATCTCCAGAAGTAGGGGATGAGGAGGCACTGAGACCTCTGACAAAGGAGAATCAGGAACCCCTGAGGTCTCTTGAAGATGAGAACAAAGAGGCCTTTAGATCTCTAGAAAAAGAGAACCAGGAGCCACTGAAGACTCTAGAAGAAGAGGACCAGAGTATTGTGAGACCTCTAGAAACAGAGAATCACAAATCACTGAGGTCTTTAGAAGAACAGGACCAAGAGACATTGAGAACTCTTGAAAAAGAGACTCAACAGCGACGGAGGTCTCTAGGGGAACAGGATCAGATGACATTAAGACCCCCAGAAAAAGTGGATCTAGAACCACTGAAGTCTCTTGACCAGGAGATAGCTAGACCTCTTGAAAATGAGAATCAAGAGTTCTTAAAGTCACTCAAAGAAGAGAGCGTAGAGGCAGTAAAATCTTTAGAAACAGAGATCCTAGAATCACTGAAGTCTGCGGGACAAGAGAACCTGGAAACACTGAAATCTCCAGAAACTCAAGCACCACTGTGGACTCCAGAAGAAATAAATCAGGGGGCAATGAATCCTCTAGAAAAGGAAATTCAAGAACCACTGGAGTCTGTGGAAGTGAACCAAGAGACATTCAGACTCCTGGAAGAGGAGAATCAGGAATCATTGAGATCTCTGGGAGCATGGAACCTGGAGAATTTGAGATCTCCAGAGGAGGTAGACAAGGAAAGTCAAAGGAATCTGGAAGAGGAAGAGAACCTGGGAAAGGGAGAGTACCAAGAGTCACTGAGGTCTCTGGAGGAGGAGGGACAGGAGCTGCCGCAGTCTGCAGATGTGCAGAGGTGGGAAGATACGGTGGAGAAGGACCAAGAACTGGCTCAGGAAAGCCCTCCTGGGATGGCTGGAGTGGAAAATGAGGATGAGGCAGAGCTGAATCTGAGGGAGCAGGATGGCTTCACTGGGAAGGAGGAGGTGGTAGAGCAGGGAGAGCTGAATGCCACAGAGGAGGTCTGGATCCCAGGCGAGGGGCACCCAGAGAGCCCTGAGCCCAAAGAGCAGAGAGGCCTGGTTGAGGGAGCCAGTGTGAAGGGAGGGGCTGAGGGCCTCCAGGACCCTGAAGGGCAATCACAACAGGTGGGGGCCCCAGGCCTCCAGGCTCCCCAGGGGCTGCCAGAGGCGATAGAGCCCCTGGTGGAAGATGATGTGGCCCCAGGGGGTGACCAAGCCTCCCCAGAGGTCATGTTGGGGTCAGAGCCTGCCATGGGTGAGTCTGCTGCGGGAGCTGAGCCAGGCCCGGGGCAGGGGGTGGGAGGGCTGGGGGACCCAGGCCATCTGACCAGGGAAGAGGTGATGGAACCACCCCTGGAAGAGGAGAGTTTGGAGGCAAAGAGGGTTCAGGGCTTGGAAGGGCCTAGAAAGGACCTAGAGGAGGCAGGTGGTCTGGGGACAGAGTTCTCCGAGCTGCCTGGGAAGAGCAGAGACCCTTGGGAGCCTCCCAGGGAGGGTAGGGAGGAGTCAGAGGCTGAGGCCCCCAGGGGAGCAGAGGAGGCGTTCCCTGCTGAGACCCTGGGCCACACTGGAAGTGATGCCCCTTCACCTTGGCCTCTGGGGTCAGAGGAAGCTGAGGAGGATGTACCACCAGTGCTGGTCTCCCCCAGCCCAACGTACACCCCGATCCTGGAAGATGCCCCTGGGCCTCAGCCTCAGGCTGAAGGGAGTCAGGAGGCTAGCTGGGGGGTGCAGGGGAGGGCTGAAGCCCTGGGGAAAGTAGAGAGCGAGCAGGAGGAGTTGGGTTCTGGGGAGATCCCCGAGGGCCCCCAGGAGGAAGGGGAGGAGAGCAGAGAAGAGAGCGAGGAGGATGAGCTCGGGGAGACCCTTCCAGACTCCACTCCCCTGGGCTTCTACCTCAGGTCCCCCACCTCCCCCAGGTGGGACCCCACTGGAGAGCAGAGGCCACCCCCTCAAGGGGAGACTGGAAAGGAGGGCTGGGATCCTGCTGTCCTGGCTTCCGAGGGCCTTGAGGCCCCACCCTCAGAAAAGGAGGAGGGGGAGGAGGGAGAAGAGGAGTGTGGCCGTGACTCTGACCTGTCAGAAGAATTTGAGGACCTGGGGACTGAGGCACCTTTTCTTCCTGGGGTCCCTGGGGAGGTGGCAGAACCTCTGGGCCAGGTGCCCCAGCTGCTACTGGATCCTGCAGCCTGGGATCGAGATGGGGAGTCCGATGGGTTTGCAGATGAGGAAGAAAGTGGGGAGGAGGGAGAGGAGGATCAGGAGGAGGGGAGGGAGCCAGGG