Transcript asmbl_119095

Sequence
Transcript Sequence for observation asmbl_119095 of TGE0059541:
TCCCGAGAAAGGGAAGTGCATTCTCGCTTCCGTAGCGGTCTCCGCCGGTTGGGGGGAAGTAATTCCGGTTGTTGCACCATGGCGTCCATGGGGACCCTCGCCTTCGATGAATATGGGCGCCCTTTCCTCATCATCAAGGATCAGGACCGCAAGTCCCGTCTTATGGGACTTGAGGCCCTCAAGTCTCATATAATGGCAGCAAAGGCTGTAGCAAATACAATGAGAACATCACTTGGACCAAATGGGCTTGATAAGATGATGGTGGATAAGGATGGAGATGTGACTGTAACTAATGATGGGGCCACCATCTTAAGCATGATGGATGTTGATCATCAGATTGCCAAGCTGATGGTGGAACTGTCCAAGTCTCAGGATGATGAAATTGGAGATGGAACCACAGGAGTGGTTGTCCTGGCTGGTGCCTTGTTAGAAGAAGCGGAGCAATTGCTAGACCGAGGCATTCACCCAATCAGAATAGCCGATGGCTATGAGCAGGCTGCTCGTGTTGCTATTGAACACCTGGACAAGATCAGCGATAGCGTCCTTGTTGACATAAAGGACACCGAACCCCTGATTCAGACAGCAAAAACCACGCTGGGCTCCAAAGTGGTCAACAGTTGTCACCGACAGATGGCTGAGATTGCTGTGAATGCCGTCCTCACTGTAGCAGATATGGAGCGGAGAGACGTTGACTTTGAGCTTATCAAAGTAGAAGGCAAAGTGGGCGGCAGGCTGGAGGACACTAAACTGATTAAGGGCGTGATTGTGGACAAGGATTTCAGTCACCCACAGATGCCAAAAAAAGTGGAAGATGCGAAGATTGCAATTCTCACATGTCCATTTGAACCACCCAAACCAAAAACAAAGCATAAGCTGGATGTGACCTCTGTCGAAGATTATAAAGCCCTTCAGAAATACGAAAAGGAGAAATTTGAAGAGATGATTCAACAAATTAAAGAGACTGGTGCTAACCTAGCAATTTGTCAGTGGGGCTTTGATGATGAAGCAAATCACTTACTTCTTCAGAACAACTTGCCTGCGGTTCGCTGGGTAGGAGGACCTGAAATTGAGCTGATTGCCATCGCAACAGGAGGGCGGATCGTCCCCAGGTTCTCAGAGCTCACAGCCGAGAAGCTGGGCTTTGCTGGTCTTGTACAGGAGATCTCATTTGGGACAACTAAGGATAAAATGCTGGTCATCGAGCAGTGTAAGAACTCCAGAGCTGTAACCATTTTTATTAGAGGAGGAAATAAGATGATCATTGAGGAGGCGAAACGATCCCTTCACGATGCTTTGTGTGTCATCCGGAACCTCATCCGCGATAATCGTGTGGTGTATGGAGGAGGGGCTGCTGAGATATCCTGTGCCCTGGCAGTTAGCCAAGAGGCGGATAAGTGCCCCACCTTAGAACAGTATGCCATGAGAGCGTTTGCCGACGCACTGGAGGTCATCCCCATGGCCCTCTCTGAAAACAGTGGCATGAATCCCATCCAGACTATGACCGAAGTCCGAGCCAGACAGGTGAAGGAGATGAACCCTGCTCTTGGCATCGACTGTTTGCACAAGGGGACAAATGATATGAAGCAACAGCATGTCATAGAAACCTTGATTGGCAAAAAGCAACAGATATCTCTTGCAACACAAATGGTTAGAATGATTTTGAAGATTGATGACATTCGTAAGCCTGGAGAATCTGAAGAATGAAGACATTGAGAAAACTATGTAGCAAGATCCACTTCTGTGATTAAGTAAATGGATGTCTCGTGATGCATCTACAGTTATTTATTGTTACATCCTTTTCCAGACACTGTAGATGCTATAATAAAAATAGCTGTTTGGTAACCATAGTTTCACTTGTTCAAAGCTGTGTAATCGTGGGGGTACCATCTCAACTGCTTTTGTATTCATTGTATTAAAAGAATCTGTTTAAACAACCTTTATCTTCTCTTCGGGTTTAAGAAACGTTTATTGTAACAGTAATTAAATGCTGCCTTAATTGAAGGGGTTTGGGTGGATTTTTTTTTCTCAAAATAAGCTGTAGGGACTATTTTAACAGCTTAAACAGGAGCTCTCAAGATGCACTTTCATATTGAGAGGAATATGGGCTTGATCCTCTTCCTATCTAAATGGGTGGGCCATTTGATTGTAGAGGGTCCACCACAGAATTATGGGATGCCTTAAGTGCTGTTACTAGGTTGCTCACAGCCTAACCTGGCGTGTTGTTTAGGGCTGATGGAGACCCATGTGAGCCTTTGCTTTCCTCTGGCCCCGGCCCCACCCTGAACACAGCTCATACACAGAATCAGGACCAGCATGTGCAGAGCTGGCCACCAGCACAGGCTTAGGGCAGTTCAGAACCCACTTGTTTCCCTATCAGAGGGACACAGTGAAGTGGAGGTTAAAGTAAATTACAGGAAATAAGGGAGAAATCTTGCAGTTACCATGTTCAGATAGAGTGACTGAAATTAATTGTACTTACTAAAGTATTAACTAGCTAACAGTGATGGGCCAAGACGCTCCGAGAACTCTACCGGGATTGTCTGTTCTGACAACCCAGTGAGGCAGATACACTTTCTTACTGCTCACATCTTACAGGTGAGTACTCATAATTGGCCAGCATCTCACCACCAGCAAGTAGTAGGGCCAGGTCAATCCCAGGCAGTCTGACCCCAGAGTGGCCCAGCTCATCCCCTACTCTGTTATTTGCTTGTTAATGATTCTCTAGATTTTCTAAAATAATGTTTCTTAGCATTGTGATGATAAAGCTCATGATGAACTTTATCACTAGTTATGCCACCTTAACTAGTCAGATTTCCTAGAATTAGGAAATGGTGACTCTTGTCTAAATTTGGTTAAGTGATGAATTTGGGTTACCGTCTCATGTGAACCTGGAGATTCACCAGTCTTAACTTTTGGGTCATTGTGTTTTCTCTACATTCATGCATTGGATGTTTTGCTAAATAACTCCTGTGGATTTAGGAATGTGTGCTAATAGCAATCTTCCTAATTTTCATGTTTATATGGAACTATGCAGTTGAGTATTGAAAGCTTTAAACTGAGTTTATTTACAAGGACTGAGTCTAGCCTACAGAGAACATACAGCAGCCTTCTTTGGACCACAGTCTTATCCGAGGGGTCTGTGGTTGTATCAGAAGAGCCACTAAACCAATCCCCCTTTCCAAAATTGAACCTCACAGACGTTCCTGTTTTTTGTGATTGAGAAACTGGTCAATGAACAGGAAGACTTAGAGATGTTTCACAAGC